 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 20, 2021 |
| Title |
IDH1R132H+/ATRX-KO (anti-CTCF snCUT&Tag) |
| Sample type |
SRA |
| |
|
| Source name |
SB28
|
| Organism |
Mus musculus |
| Characteristics |
age: NA
Sex: NA
genotype/variation: IDH1R132H+/ATRX-KO
|
| Growth protocol |
An ATRX CRISPR double-nickase plasmid (Santa Cruz Biotech sc-423734-NIC) was transfected into SB28 mouse glioma cells (a kind gift from Prof. Okada, UCSF) using FuGENE transfection reagent (Promega, Catalog number E2311). The CRISPR guide-RNAs used were CTAACTATGACTCAGAGTTAGAGAGAGAGATAAAAACCATGAGCAGAATT and CTAACTATGACTCAGAGTTAGAGAGAGAGATAAAAACCATGAGCAGAATT target exon 9 of ATRX. Non-targeting guide-RNAs were expressed in controls (Santa Cruz Biotech sc-437281). Following selection via puromycin, single cells were sorted into multi-well plates and expanded as clones. Homozygous knockout was validated by a cleavage assay (Thermofisher, Catalog number: A24372), using primers F: CTACTTCCGGGTCAGATTTTGA and R: GCACCATCAGAGGAAACACC. Complete loss of ATRX protein was validated by Western blot (Abcam # ab97508). SB28ATRX-KO cells were transfected with plasmids expressing either IDH1R132H (ORIGENE, CAT#: RC400096) or wildtype IDH1 (Origene CAT#: RC210582) and selected via neomycin. Cells were cultured in RPMI media supplemented with 10% FBS and 100 U/mL penicillin and 0.1% streptomycin.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Tagmentation for scATAC-seq, as well as nuclei capture and library prep for all single-cell assays, was performed via the 10X Genomics platform. Antibody incubation and tagmentation for scCUT&Tag was done as in Kaya-Okur Nature Communications 2019, with the following modifications. Cell lysis was performed via Nuclei EZ Prep (Sigma) according to manufacturer’s instructions. Nuclei purification was performed as above via sucrose gradient. Following centrifugation, nuclei were resuspended in 200 ul of Nuclei buffer (10X Genomics) with a 1:50 dilution of primary antibody (anti-CTCF Diagenode C15410210-50) and incubated overnight at 4 °C with slow rotation. Nuclei were spun down and resuspended in 200 ul of Nuclei buffer with a 1:50 dilution of secondary antibody (Antibodies-online ABIN3042027) and a 1:100 dilution of pA-Tn5 transposase loaded with Illumina barcodes (Diagenode C01070001), then incubated for 1 hr at room temperature with slow rotation. Nuclei were counted in a Countess II, then washed and resuspended with sufficient Nuclei buffer to achieve a concentration of 2000 nuclei/ul. To perform tagmentation, 5 ul of nuclei suspension was added to 7 ul of ATAC buffer (10X Genomics) and 2 ul of 1:100 loaded pA-Tn5 and incubated at 37 °C for 1 hr. Nuclei capture and library prep was then performed according to 10X Genomics scATAC-seq protocol. Sequencing was performed according to 10X Genomics recommended protocols on an Illumina NovaSeq 6000.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Data processing |
Library strategy: snCUT&Tag
We used CellRanger (version 3.0.2) to pre-process the sc/snRNA-seq data from the 10X Genomics platform.
The CellRanger ATAC software (version 1.1.0) was used for read alignment, deduplication, and identifying transposase cut sites.
The output matrix of CellRanger was further filtered for quality based on two criteria: 1) number of fragments > 1000; 2) fragments in promoter ratio > 0.2.
Genome_build: hg38, mm10
Supplementary_files_format_and_content: Filtered peak matrix (.mtx) files. Bed files, peaks (TSV).
|
| |
|
| Submission date |
Aug 18, 2021 |
| Last update date |
Oct 27, 2021 |
| Contact name |
Aaron Diaz |
| E-mail(s) |
aaron.diaz@ucsf.edu
|
| Organization name |
University of California, San Francisco
|
| Department |
Neurological Surgery
|
| Lab |
Diaz Lab
|
| Street address |
1450 3rd St
|
| City |
San Francisco |
| State/province |
CA |
| ZIP/Postal code |
94158 |
| Country |
USA |
| |
|
| Platform ID |
GPL24247 |
| Series (1) |
| GSE155430 |
A single-cell epigenetic atlas of human IDH-mutant glioma |
|
| Relations |
| BioSample |
SAMN20849978 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5527815_SB28IDHmtATRXko_barcodes.txt.gz |
1.4 Kb |
(ftp)(http) |
TXT |
| GSM5527815_SB28IDHmtATRXko_matrix.mtx.gz |
10.5 Mb |
(ftp)(http) |
MTX |
| GSM5527815_SB28IDHmtATRXko_peaks.bed.gz |
832.7 Kb |
(ftp)(http) |
BED |
| Processed data provided as supplementary file |
| Raw data not provided for this record |
|
|
|
|
 |
