 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 05, 2021 |
| Title |
E9.5 trunk WT cHiC rep1 |
| Sample type |
SRA |
| |
|
| Source name |
Embryonic trunk
|
| Organism |
Mus musculus |
| Characteristics |
developmental stage: E9.5
tissue: Embryonic trunk
strain: B6CBAF1
genotype: WT
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Micro-dissected E12.5 proximal and distal forelimb pairs and individual E9.5 trunks were isolated in PBS supplemented with 10% Fetal Calf Serum and dissociated into single cell by collagenase treatment (8ul of collagenase 50mg/ml (Sigma C9697) at 37º for approximately 10min). Samples were cross-linked with 1% formaldehyde (ThermoFisher 28908) for 10 minutes at room temperature, quenched with glycine and washed with PBS containing proteinase inhibitor. After discarding the supernatant cells were stored at -80º. Samples were genotyped by PCR to select for homozygous mutant or control tissues. Further processing was performed as described in (Yakushiji-Kaminatsui et al., 2018)
Following the Hi-C protocol, ligated DNA fragments were processed throught the Agilent SureSelectXT protocol to enrich for fragments coming from the probe region chr2:72240000-76840000 (mm9).
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Description |
Capture Hi-C
|
| Data processing |
Library strategy: Capture HiC
All scripts are available on https://github.com/lldelisle/scriptsForAmandioEtAl2021
Raw reads were preprocessed with cutadapt version 1.16 (Martin 2011 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT --minimum-length=15 --pair-filter=any --quality-cutoff=30).
Then hicup version 0.6.1 (Dryden et al. 2014) with bowtie2 version 2.2.6 (Langmead et al. 2012) and samtools 1.2 (Danecek et al. 2021) were used with default parameters.
The bam file was converted to tabular file with a python script (see https://github.com/lldelisle/scriptsForAmandioEtAl2021 for more details).
The pairs with both mates MAPQ30 and in the capture region (chr2:72402000-77000000) were then loaded to a 10kb resolution matrices with cooler version 0.7.4 (Abdennur and Mirny 2020).
The merge matrices were obtained using HiCExplorer hicSumMatrices tool version 3.6 (Ramirez et al. 2018, Wolff et al. 2018 and Wolff et al. 2020) and cooler balance.
Genome_build: mm10
Supplementary_files_format_and_content: validPairs_filtered.csort.txt: valid pairs in juicebox format: Each line is a pair: <readname> <str1> <chr1> <pos1> <frag1> <str2> <chr2> <pos2> <frag2> <mapq1> <mapq2> str = strand (0 for forward, anything else for reverse). Only pairs with both mates MAPQ30 and in the capture region (chr2:72402000-77000000).
Supplementary_files_format_and_content: 10kb.cool: 10kb matrices ICEd normalized
Supplementary_files_format_and_content: merge_10kb.cool: 10kb matrices ICEd normalized of both replicates combined
|
| |
|
| Submission date |
Aug 03, 2021 |
| Last update date |
Oct 05, 2021 |
| Contact name |
Lucille Lopez-Delisle |
| E-mail(s) |
lucille.delisle@epfl.ch
|
| Organization name |
EPFL
|
| Street address |
Station 19
|
| City |
Lausanne |
| ZIP/Postal code |
1015 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL21103 |
| Series (2) |
| GSE181386 |
Cumulative in-cis mutagenesis in vivo reveals various functions for CTCF sites at the mouse Hoxd cluster [cHi-C] |
| GSE181387 |
Cumulative in-cis mutagenesis in vivo reveals various functions for CTCF sites at the mouse Hoxd cluster |
|
| Relations |
| BioSample |
SAMN20554964 |
| SRA |
SRX11642623 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5501465_E9.5_trunk_WT_cHiC_rep1_10kb.cool.gz |
1.9 Mb |
(ftp)(http) |
COOL |
| GSM5501465_E9.5_trunk_WT_cHiC_rep1_validPairs_filtered.csort.txt.gz |
15.1 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
