 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 05, 2021 |
| Title |
E10.5 trunk WT ChIPM RAD21 rep4 |
| Sample type |
SRA |
| |
|
| Source name |
Embryonic trunk
|
| Organism |
Mus musculus |
| Characteristics |
developmental stage: E10.5
tissue: Embryonic trunk
strain: B6CBAF1
genotype: WT
chip-m antibody: RAD21 (Abcam #ab992)
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
ChIP-M experiments for CTCF and RAD21 were performed according to (Darbellay et al., 2019a). Briefly, trunk regions of E10.5 embryos (from below the post-occipital region) derived from trans-heterozygous crosses were individually dissociated into single cells with collagenase and fixed in 1% formaldehyde solution for 10 minutes at room temperature. The crosslinking reaction was stopped adding Glycine to a final concentration of 0,125 M and the cell pellet was washed three times with cold PBS with protease inhibitors (Complete mini EDTA –free proteinase inhibitor cocktail; Roche). Fixed samples were stored at -80C. Yolk sacs were used for genotyping. Samples from homozygous mutant embryos or control littermates were resuspended in sonication buffer (Tris HCl pH=8.0 50mM; EDTA 10 mM SDSS 0,25%; protease inhibitors) and the chromatin was sheared in a Covaris S200 sonicator to an average fragment size of 250-300 bp. The sonicated chromatin was diluted 2.5 times with dilution buffer (HEPES pH=7.3 20mM; EDTA 1mM; NP40 1%; NaCL 150mM; protease inhibitors). Antibodies against CTCF (Active Motif #61311; 4gr) or RAD21 (Abcam # ab992; 5ugr) were conjugated with Dynabeads Protein G (Thermofisher) magnetic beads. The bead-antibodies complexes were added to the diluted chromatin and incubated overnight at 4oC in a rotating platform. The day after, chromatin-antibody complexes were washed using a magnetic stand with RIPA buffer (Tris HCl pH=8.0 10mM; EDTA 1mM; Sodium Deoxycholate 0,1% TritonX-100 1%; NaCl 140mM; two washes); RIPA-High salt buffer (Tris HCl pH=8.0 10mM; EDTA 1mM; Sodium Deoxycholate 0,1% TritonX-100 1%; NaCl 500mM; two washes), LiCl-buffer; (Tris HCl pH=8.0 10mM; EDTA 1mM; LiCl 250mM; Sodium Deoxycholate 0,5% NP40 0,5%; two washes) and Tris HCl 10mm pH=8.0 (two washes). The chromatin was then tagmented for two minutes with the Tn5 transposase (Illumina). Tagmented chromatin was eluted, reverse crosslinked and purified using Qiagen Minielute columns. Libraries were quantified using the Kapa library quantification kit and PCR amplified using barcoded primers. ChIP-M libraries were pair-end sequenced in an NextSeq 500 sequencer (PE 2x 37-43bp).
Nextera library construction were done following the published ChIPmentation protocol (Schmidl, 2015)
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
ChIPmentation
|
| Data processing |
Library strategy: ChIPmentation
All scripts are available on https://github.com/lldelisle/scriptsForAmandioEtAl2021
Adapters and bad quality bases were removed from the fastqs with cutadapt version 1.16 (Martin 2011 -a CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -A CTGTCTCTTATACACATCTGACGCTGCCGACGA -q 30 -m 15).
Filtered reads were mapped to the mouse genome mm10 with bowtie2 version 2.3.5 (Langmead et al. 2012 with default options).
Only alignments with a mapping quality above 30 were kept (samtools version 1.9 Danecek et al. 2021).
PCR duplicates were removed with Picard version 2.19.0.
To decrease the importance of fragment length variation between libraries only the first read in pairs were kept and BAM was converted to BED.
Peak calling was run with a fixed fragment size of 200bp with macs2 callpeak version 2.1.1.20160309 ( --call-summits -f BED --nomodel --extsize 200 -B --keep-dup all).
In order to normalize all ChIP-M despite different signal to noise ratios, we run MAnorm version 1.1.4 (Shao et al. 2012 with -w 100) between each sample and the second replicate of the wildtype. The M-A model coefficient was extracted and used to normalize each bedgraph from macs2 (see https://github.com/lldelisle/scriptsForAmandioEtAl2021 for all details).
Replicates were then averaged at each base using bedtools version 2.27.1 (Quinlan et al. 2010).
In parallel, the coverages from macs2 were normalized to the million tags. Then replicates were averaged.
Genome_build: mm10
Supplementary_files_format_and_content: bw: coverage normalized to the million tags
Supplementary_files_format_and_content: _MAnorm.bw: coverage normalized using MAnorm compared to the WT rep2
Supplementary_files_format_and_content: neqN.bw: average between N replicates of the coverage normalized to the million tags
Supplementary_files_format_and_content: MAnorm_neqN.bw: average between N replicates of the coverage normalized using MAnorm
Supplementary_files_format_and_content: narrowPeak: narrowPeak from macs2
|
| |
|
| Submission date |
Aug 03, 2021 |
| Last update date |
Oct 05, 2021 |
| Contact name |
Lucille Lopez-Delisle |
| E-mail(s) |
lucille.delisle@epfl.ch
|
| Organization name |
EPFL
|
| Street address |
Station 19
|
| City |
Lausanne |
| ZIP/Postal code |
1015 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE181384 |
Cumulative in-cis mutagenesis in vivo reveals various functions for CTCF sites at the mouse Hoxd cluster [ChIPmentation] |
| GSE181387 |
Cumulative in-cis mutagenesis in vivo reveals various functions for CTCF sites at the mouse Hoxd cluster |
|
| Relations |
| BioSample |
SAMN20554942 |
| SRA |
SRX11642574 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5501416_E10.5_trunk_WT_ChIPM_RAD21_rep4.bw |
237.8 Mb |
(ftp)(http) |
BW |
| GSM5501416_E10.5_trunk_WT_ChIPM_RAD21_rep4.narrowPeak.gz |
957.4 Kb |
(ftp)(http) |
NARROWPEAK |
| GSM5501416_E10.5_trunk_WT_ChIPM_RAD21_rep4_MAnorm.bw |
513.1 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
