 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 05, 2021 |
| Title |
E12 PFL ChIP CTCF_re-analyzed |
| Sample type |
SRA |
| |
|
| Source name |
Proximal forelimb
|
| Organism |
Mus musculus |
| Characteristics |
developmental stage: E12.5
tissue: Proximal forelimb
strain: B6CBAF1
genotype: WT
chip antibody: CTCF (Active Motif #61311)
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
For the posterior trunk sample, the portion corresponding to the tailbud, presomitic mesoderm, and 2-3 somite pairs, excluding as much as possible the region of the evaginating hindlimb buds, was micro-dissected from approximately thirty E9.75-E10 embryos. For the brain sample, a pool of six micro-dissected telencephalons from E12.5 embryos was used. CTCF ChIP-seq experiments were performed as described in (RodrÃguez-Carballo et al 2017).
Libraries were prepared as described in RodrÃguez-Carballo et al., 2017
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
ChIP
GSM2713708
|
| Data processing |
All scripts are available on https://github.com/lldelisle/scriptsForAmandioEtAl2021
TrueSeq adapters were removed from single-reads fastqs with cutadapt version 1.16 (Martin 2011 -a CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -q 30 -m 15).
Filtered reads were mapped to the mouse genome mm10 with bowtie2 version 2.3.5 (Langmead et al. 2012 with default options). Only alignments with a mapping quality above 30 were kept (samtools version 1.9 Danecek et al. 2021).
Peak calling was run with a fixed fragment size of 200bp with macs2 callpeak version 2.1.1.20160309 (--call-summits --nomodel --extsize 200 -B).
Finally the coverage were normalized to the million unique tags.
Genome_build: mm10
Supplementary_files_format_and_content: bw: normalized coverage track
Supplementary_files_format_and_content: narrowPeak: narrowPeak from macs2
|
| |
|
| Submission date |
Aug 03, 2021 |
| Last update date |
Oct 05, 2021 |
| Contact name |
Lucille Lopez-Delisle |
| E-mail(s) |
lucille.delisle@epfl.ch
|
| Organization name |
EPFL
|
| Street address |
Station 19
|
| City |
Lausanne |
| ZIP/Postal code |
1015 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL17021 |
| Series (2) |
| GSE181383 |
Cumulative in-cis mutagenesis in vivo reveals various functions for CTCF sites at the mouse Hoxd cluster [ChIP-seq] |
| GSE181387 |
Cumulative in-cis mutagenesis in vivo reveals various functions for CTCF sites at the mouse Hoxd cluster |
|
| Relations |
| Reanalysis of |
GSM2713708 |
| BioSample |
SAMN20554761 |
| SRA |
SRX11642542 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5501398_E12_PFL_ChIP_CTCF.bw |
582.0 Mb |
(ftp)(http) |
BW |
| GSM5501398_E12_PFL_ChIP_CTCF.narrowPeak.gz |
1.8 Mb |
(ftp)(http) |
NARROWPEAK |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
