 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Nov 15, 2021 |
| Title |
Circular.200.100(PCSK9)-M1 |
| Sample type |
SRA |
| |
|
| Source name |
Liver from C57BL6/J mouse
|
| Organism |
Mus musculus |
| Characteristics |
tissue: Liver
treatment: Mouse injected with AAV8-circular.200.100(PCSK9)-mCherry
|
| Treatment protocol |
AAV injection via retro-orbital route.
|
| Growth protocol |
All experiments were carried out in 6 week old C57BL6/J mice. These mice were litter mates and obtained from Jackson Labs.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA extraction from mice livers was carried out using QIAzol Lysis Reagent and purified using RNeasy Plus Universal Mini Kit (Qiagen), according to the manufacturer’s protocol.
RNA-seq libraries were prepared from 500ng RNA using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
AAVs injected via retro-orbital injections and mouse harvested 2 weeks post injections. This mouse is injected with AAV8 carrying a ribozyme flanked antisense RNA (targeting the PCSK9 transcript) and results in the formation of a circular guide in vivo.
|
| Data processing |
Basecalls were performed using Illumina RTA3, and fastq files were then generated using Illumina bcl2fastq2 v2.20. Both tasks were carried out by the UCSD IGM Genomics Center.
Sequence read pairs from stranded RNA-seq libraries were mapped to the reference mouse genome mm39 by running STAR aligner version 2.7.7a with the following command line options: --clip3pAdapterSeq AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (to trim Illumina adapter sequences from the 3′ ends of the reads in each pair), --quantMode GeneCounts (to collect read counts for each gene), --alignSJDBoverhangMin 1 (following ENCODE standard practice), --peOverlapNbasesMin=10 --peOverlapMMp=0.05 (to correctly align pairs of overlapping reads), --outSAMmultNmax 1 (to limit output of multimapping reads), --alignEndsType EndToEnd (to avoid soft-clipping of reads), --outFilterMismatchNmax -1 --outFilterMismatchNoverReadLmax 0.2 --outFilterMultimapNmax 1 (to increase the likelihood of successful alignment for reads containing A-to-I editing events). The genome index for STAR aligner was built using transcript annotations from Gencode release M27 for the mouse genome assembly GRCm39. Each aligned read was retained for downstream analysis even when the corresponding mate in the pair could not be successfully aligned.
Samtools version 1.11 was used to sort the aligned reads by genomic coordinate and to mark duplicated single or paired reads.
The uniquely aligned reads for each sample were down-sampled using samtools view with option -s. Down-sampling fractions were calculated by dividing the smallest number of uniquely aligned reads among all samples by the number of uniquely aligned reads available for the sample being down-sampled. Down-sampling was not performed on the reads of the control samples. To handle transcripts oriented as the forward reference strand, base counts were collected at reference A-sites using the second (first) read in a pair, if that read was mapped to the forward (reverse) reference strand. Conversely, to handle transcripts oriented as the reverse reference strand, base counts were collected at reference T-sites using the first (second) read in a pair, if that read was mapped to the forward (reverse) reference strand. The C library htslib (github.com/samtools/htslib), version 1.12, was used to enumerate the aligned reads that overlapped each base position in the reference genome, while avoiding double-counts of bases in regions covered by both reads in a pair. Reference sites covered by less than ten reads were ignored. The value of the SAM tag MD, “String for mismatching positions”, recorded by samtools calmd version 1.11 in each alignment record, was used to determine the reference base at each position of an aligned sequence read. Base deletions and insertions relative to the reference genome were ignored. Sequenced bases with a Phred quality score less than 13 were ignored. For each sample, an initial list of base counts from reads overlapping each selected reference A- and T-site was generated. The initial lists of base counts from all samples were then used to generate a final list of reference A- and T-sites where such base counts were available for all samples, and where at least one sample had a non-zero count of G (C) at reference A-sites (T-sites).
At each selected reference site in the final list, a pairwise comparison between the base counts for each treatment sample and those for the control sample was carried out using Fisher’s exact test, as implemented in R function fisher.test, with a 2-by-2 contingency table containing the counts of G (C) at reference A-sites (T-sites) in the first row, the counts of all other bases at those sites in the second row, the base counts for the control sample in the first column, and the base counts for the compared treatment sample in the second column. The resulting p-values were adjusted for multiple comparisons using the method of Benjamini and Hochberg, as implemented in R function p.adjust. The proportion of the number of G (C) bases relative to the number all bases was also calculated at each A-site (T-site). Reference A-sites (T-sites) with a significant change in such base proportion for at least one comparison between a treatment sample and the control sample were selected by requiring an adjusted p-value less than 0.01 and a fold change greater than 1.1 in either direction.
RNA-seq libraries from mice were analyzed for differential gene expression using the Bioconductor package DESeq2 version 1.28.1. The per-gene counts of aligned read for each of four samples were collected by STAR aligner version 2.7.7a into a corresponding ReadsPerGene.out.tab file (submitted with name pattern pm_adar_rnas_011-eadcgm_seq_rna_rc_mapr_*_res-rpg-0.tsv.gz). The read counts corresponding to “the 2nd read strand aligned with RNA” were loaded for all samples into a DESeq2::DESeqDataSet object. Genes with less than 10 read counts in all samples were discarded. The counts for the remaining genes were processed using R function DESeq2::DESeq with default parameters. The comparison between untreated and treated mice was carried out using R function DESeq2::results with default parameters, except that the significance cutoff for independent filtering optimization was set to 0.01. Shrinkage of effect sizes was carried out using R function DESeq2::lfcShrink with default parameters.
Genome_build: mm39
Supplementary_files_format_and_content: The measured base proportions for each off-target site (row) and sample (column) are reported in processed data file pm_adar_rned_011-eadcgm_seq_rna_ed_bfscr_0-0_res-bpr-0.tsv.gz (tab separated values, compressed with gzip). The adjusted p-values for the comparison (column) of base proportion between each sample and the control sample at each off-target site (row) are reported in processed data file pm_adar_rned_011-eadcgm_seq_rna_ed_bfscr_0-0_res-pad-0.tsv.gz. Processed data files with name pattern pm_adar_rnas_011-eadcgm_seq_rna_rc_mapr_*_res-rpg-0.tsv.gz contain per-gene read counts generated by the STAR aligner software.
|
| |
|
| Submission date |
Jul 01, 2021 |
| Last update date |
Nov 15, 2021 |
| Contact name |
Dario Meluzzi |
| Organization name |
UC San Diego
|
| Department |
School of Medicine
|
| Lab |
George Palade Laboratories 345
|
| Street address |
9500 Gilman Drive #0648
|
| City |
La Jolla |
| State/province |
CA |
| ZIP/Postal code |
92093-0648 |
| Country |
USA |
| |
|
| Platform ID |
GPL24247 |
| Series (1) |
| GSE164956 |
Robust RNA editing via recruitment of endogenous ADARs using circular guide RNAs |
|
| Relations |
| BioSample |
SAMN19998592 |
| SRA |
SRX11329290 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5413989_pm_adar_rnas_011-eadcgm_seq_rna_rc_mapr_0_res-rpg-0.tsv.gz |
333.1 Kb |
(ftp)(http) |
TSV |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
