NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM5350266 Query DataSets for GSM5350266
Status Public on Sep 15, 2021
Title Case4
Sample type SRA
 
Source name canine acanthomatous ameloblastoma tumor
Organism Canis lupus familiaris
Characteristics breed: Golden retriever
Sex: Male
dog age: 10
sample type: CAA
sample location: Rostral maxilla
Treatment protocol none
Growth protocol Tumor biopsies were collected during standard-of-care surgical procedures, and stored by the Cornell Veterinary Biobank at Cornell University’s College of Veterinary Medicine
Extracted molecule total RNA
Extraction protocol Cryopreserved tissue was homogenized in Trizol on a bead mill using 2.8mm ceramic beads. Total RNA was isolated from the Trizol lysate, with an extra chloroform extraction to remove residual phenol and addition of glyco-blue as a carrier to promote RNA precipitation. RNA concentration was determined with a Nanodrop and integrity assessed on a Fragment Analyzer.
Directional RNA-seq libraries were prepared from 250ng total RNA using the NEBNext Directional Ultra II RNA Library Prep Kit for Illumina (New England Biolabs), with initial polyA+ enrichment.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NextSeq 500
 
Description genes.read_group_tracking:CAA_4
Data processing Illumina pipeline software was used for base calling.
cutadapt v1.8.3 (-m 50 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads.
tophat v2.1.1 (--no-novel-juncs --library-type fr-firststrand) was used to map reads to the canine CanFam3 reference genome+transcriptome (UCSC).
cuffdiff v2.2.1 (--library-type fr-firststrand) was used to call differentially expressed genes based on the CanFam3 reference genome+transcriptome (Ensembl).
Genome_build: CanFam3 (Ensembl)
Supplementary_files_format_and_content: Tab delimited text files are standard cuffdiff2 output files for gene-level analysis, including counts, FPKM values, and q-values for differential expression testing (corrected for multiple hypothesis testing). The 'gene_exp.diff' file contains average FPKM values for each pair of replicates as well as results for statistical testing for differential expression. The 'genes.read_group_tracking' file contains raw mapped read counts and FPKM values for individual samples.
 
Submission date Jun 01, 2021
Last update date Sep 15, 2021
Contact name Jennifer K Grenier
Organization name Cornell University
Department Biomedical Sciences
Lab Biotechnology Building rm 333
Street address 526 Campus Rd
City Ithaca
State/province NY
ZIP/Postal code 14853
Country USA
 
Platform ID GPL21400
Series (1)
GSE175876 Transcriptional profiling of canine acanthomatous ameloblastoma
Relations
BioSample SAMN11478852
SRA SRX5726318

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap