NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM5268957 Query DataSets for GSM5268957
Status Public on Mar 09, 2022
Title Veros-APO-moi-0p1
Sample type SRA
 
Source name Vero E6 cells overexpressing APOBEC1
Organism Chlorocebus sabaeus
Characteristics cell line: Vero E6
agent: SARS-CoV-2
Treatment protocol Vero E6 and A549-ACE2 cells were treated with 1µg/ml doxycyline and infected with SARS-CoV-2 at MOI 0.1 and MOI 3, respectively, for 48 hours before treating with Trizol.
BEAS-2B cells were treated with Trizol when 70-90% confluent.
Growth protocol Vero E6 and A549-ACE2 cells were cultured in DMEM supplemented with 10% FBS.
BEAS-2B cells were cultured on Matrigel (Corning) coated plates and maintained in the PneumaCult-Ex Plus Medium (Stem Cell Technologies), supplemented with 33 µg/ml hydrocortisone (Stem Cell Technologies). Growth media was replaced every two days, and the cells were passaged every four days. Vero E6 cells were cultured in DMEM (ThermoFisher) supplemented with 10% FBS (ThermoFisher) and passaged every three days. All cell cultures were incubated at 37ºC and 5% CO2.
Extracted molecule total RNA
Extraction protocol Trizol extraction (Fisher) and Direct-zol miniprep (Zymo Research) column purification in accordance with manufacturer protocol
Illumina Stranded mRNA Prep kit
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NovaSeq 6000
 
Description Vero E6 infected with SARS-CoV-2 at MOI 0.1 for 48 hours
Data processing Raw reads were trimmed using cutadapt (v1.14) using the following parameters -O 5 -f fastq --match-read-wildcards --times 2 -e 0.0 --quality-cutoff 6 -m 18 -o data.fastqTr.fq -b TCGTATGCCGTCTTCTGCTTG -b ATCTCGTATGCCGTCTTCTGCTTG -b CGACAGGTTCAGAGTTCTACAGTCCGACGATC -b GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -b AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA -b TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT data.fastq.gz
Trimmed reads were mapped to and filtered of repeat elements (RepBase 18.05) with STAR (2.5.2) using the following parameters: --alignEndsType EndToEnd --genomeDir repbase --genomeLoad NoSharedMemory --outBAMcompression 10 --outFileNamePrefix data --outFilterMultimapNmax 10 --outFilterMultimapScoreRange 1 --outFilterScoreMin 10 --outFilterType BySJout --outReadsUnmapped Fastx --outSAMattrRGline ID:foo --outSAMattributes All --outSAMmode Full --outSAMtype BAM Unsorted --outSAMunmapped Within --outStd Log --readFilesIn data.fastqTr.fq --runMode alignReads --runThreadN 8
Reads unmapped to repeat elements were mapped to the human genome with STAR using the same parameters as the previous step, using an hg19/ChlSab2 index in place of the repeat element index
Subread featureCounts (-a gencode.v19.annotation.gtf -s 2 -p -o counts.txt data.bam) was used to count features using human annotations (Gencode v19)
Genome_build: ChlSab2
Genome_build: hg19
Supplementary_files_format_and_content: BigWig
 
Submission date Apr 28, 2021
Last update date Mar 09, 2022
Contact name Gene Yeo
E-mail(s) geneyeo@ucsd.edu
Organization name UCSD
Street address 2880 Torrey Pines Scenic Dr. Room 3805/Yeo Lab
City La Jolla
State/province CA
ZIP/Postal code 92037
Country USA
 
Platform ID GPL28895
Series (2)
GSE173507 Discovery and functional interrogation of the virus and host RNA interactome of SARS-CoV-2 proteins [RNA-Seq]
GSE173508 Discovery and functional interrogation of the virus and host RNA interactome of SARS-CoV-2 proteins
Relations
BioSample SAMN18907461
SRA SRX10700588

Supplementary file Size Download File type/resource
GSM5268957_Veros-APO-moi-0p1_S1_L004_R1_001.fastqTr.sorted.STARUnmapped.out.sorted.STARAligned.out.sorted.bam.neg.bw 79.3 Mb (ftp)(http) BW
GSM5268957_Veros-APO-moi-0p1_S1_L004_R1_001.fastqTr.sorted.STARUnmapped.out.sorted.STARAligned.out.sorted.bam.pos.bw 77.9 Mb (ftp)(http) BW
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap