|
| Status |
Public on Dec 05, 2021 |
| Title |
Colon DSS day14 |
| Sample type |
SRA |
| |
|
| Source name |
Colon
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL/6J
tissue: colon
genotype: wild type
treatment: DSS
|
| Treatment protocol |
Wild type C57BL/6J mice were exposed to DSS in drinking water for 7 days and then allowed to recover for 7 more days.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Mouse colonic tissues were collected either on day 0 (without any exposure to DSS) or on day14 after exposure to DSS, Swisrolled and frozen in OCT. Mouse colonic tissues (day0 and day14) were cryo-sectioned (10uM) and placed on the already barcoded spots (6.5mm x 6.5mm) on the glass slide.
RNA libraries were prepared for sequencing following the 10x Genomics Visium protocol
Spatial Transcriptomics (Visium)
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Data processing |
Library strategy: Spatial Transcriptomics
bcl2fastq command line tool was used for base calling
Sequence reads were trimmed for adapter sequence (Template Switch Oligo) and polyA homopolymers using cutadapt (-g XAAGCAGTGGTATCAACGCAGAGTACATGGG;max_error_rate=0.1 -a AAAAAAAAAA ;max_error_rate=0--overlap 5 -n 2)
Reads were mapped, annotated and demultiplexed using the spaceranger v1.0.0 command line tool
Annotated reads were quantified and mapped to the Hematoxylin and Eosin image using the spaceranger v1.0.0 command line tool
Genome_build: mm10 (Ensembl 93)
Supplementary_files_format_and_content: raw_feature_bc_matrix.h5 (Matrix with raw counts for every gene and every spot)
Supplementary_files_format_and_content: filtered_feature_bc_matrix.h5 (Matrix with raw counts for every gene and every spot, filtered to include spots under tissue)
Supplementary_files_format_and_content: tsv (Matrix with normalized values. Normalization was done using variance stabilizing transformation as implemented in the R package sctransform v0.2.1 and Seurat v3.1.5)
Supplementary_files_format_and_content: tif (Hematoxylin and Eosin (HE) image in TIF format)
Supplementary_files_format_and_content: png (Low resolution Hematoxylin and Eosin (HE) image in PNG format)
Supplementary_files_format_and_content: json (Scalefactors in json format)
Supplementary_files_format_and_content: csv (Table with array and pixel coordinates)
|
| |
|
| Submission date |
Mar 26, 2021 |
| Last update date |
Dec 05, 2021 |
| Contact name |
Ludvig Ale Larsson |
| E-mail(s) |
ludvig.larsson@scilifelab.se
|
| Phone |
+46739911122
|
| Organization name |
SciLifeLab
|
| Department |
Gene Technology
|
| Street address |
Tomtebodavägen 23A
|
| City |
Solna |
| State/province |
Stockholm |
| ZIP/Postal code |
17165 |
| Country |
Sweden |
| |
|
| Platform ID |
GPL24247 |
| Series (1) |
| GSE169749 |
10X Visium Spatial transcriptomics of murine colon in steady state and during recovery after DSS colitis |
|
| Relations |
| BioSample |
SAMN18510725 |
| SRA |
SRX10457828 |
