 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Nov 21, 2022 |
| Title |
RNAseq_Klf4KO_ESC_c1_BR2 |
| Sample type |
SRA |
| |
|
| Source name |
mouse embryonic stem cell V6.5
|
| Organism |
Mus musculus |
| Characteristics |
cell line: V6.5
cell type: embryonic stem cell line
subpopulation: unsorted
genotype: Klf4 KO
biological replicate: 2
|
| Treatment protocol |
None
|
| Growth protocol |
V6.5 mouse embryonic stem cells (ESC) were cultured on tissue culture-treated 10cm plates pre-coated with 0.2% gelatin in phosphate-buffered saline (PBS). ESC were cultured in Dulbecco’s Modified Eagle Medium (Fisher), plus 10% fetal bovine serum, 1x penicillin/streptomycin, 1x non-essential amino acids, 1x β-mercaptoethanol, and 1000 U ml-1 leukemia inhibitor factor. All cells were grown at 37C and 5% CO2 and passaged every two days to maintain 10-70% confluency.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
scRNAseq: Single-cell suspension of V6.5 mESC was made by treatment with 0.25% trypsin followed by inactivation in complete medium. Single-cell isolation and library preparation was done using a 10x Genomics Chromium machine in 3’ RNA digital gene expression mode. scATACseq: Single-nuclei suspension of V6.5 mESC was isolated following the 10x Genomics nuclei isolation protocol (CG000169 Rev D). mPROseq: The PROseq protocol established in Mahat et al. 2016 was modified to enable small cell input and performed. ATACseq: Library preparation was performed according to protocol established in Buenrostro et al. 2013 (PMID 24097267), Buenrostro et al. 2015 (PMID 25559105). RNAseq: RNA was extracted by standard Trizol protocol. rRNA-depleted RNA sequencing libraries were prepared using KAPA RNA HyperPrep Kit with RiboErase (Roche 08098140702) to manufacturer’s instructions.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
HiSeq X Ten |
| |
|
| Description |
RNAseq
rRNA-depleted, steady state RNA
|
| Data processing |
scRNAseq: Cellranger (v.3.1.0) mkfastq and count pipelines were used for: demultiplexing, converting to fastq format, combining sequencing results, alignment to GRCm38 (mm10) genome assembly and gene annotation, barcode processing, and UMI counting.
scATACseq: Cellranger ATAC (v.1.1.0) mkfastq and count pipelines were used for demultiplexing sequencing results and converting to fastq format, as well as alignment to GENCODE vM17 basic genome annotation, barcode processing, and UMI counting.
mPROseq: Raw reads were processed using fastxtoolkit (v.0.0.13). Fastq files were converted to fasta format using the fastq_to_fasta command with parameter -n. Adapter sequence was removed using fastx_clipper with parameters -n -a ATCTCGTATGCCGTCTTCTGCTTG -l 14. PCR duplicates were removed using fastx_collapser with default parameters. The 6bp unique molecular identifier (UMI) was removed using fastx_trimmer (-f 7). Then, libraries were demultiplexed using fastx_barcode_splitter with parameters --mismatches 2 --partial 1. Library barcodes were trimmed using fastx_trimmer (-f 10). The reverse complement of trimmed sequences were obtained using fastx_reverse_complement and aligned to the mm10 reference genome using Bowtie2 (v.2.3.5.1) with parameter --sensitive-local -f. Reads per genomic content (RPGC)-normalized bigWig files were generated from bam files using the BamCoverage function in the deeptools package (v.3.0.1) with parameters --normalizeUsing RPGC --effectiveGenomeSize 2652783500 --centerReads -e 150.
ATACseq: Reads were trimmed for adapter sequences using TrimGalore (v.0.6.5) (--paired --nextera). Paired-end reads were aligned to the mm10 reference genome using Bowtie2 (v.2.3.5.1) (--very-sensitive -k 10) and filtered for autosomal, properly-paired, mapped read pairs with mapping quality >= 30 using samtools (v.1.10) view (-b -h -f 3 -F 4 -F 8 -F 256 -F 1024 -F 2048 -q 30). Peak calling was performed separately for each sample using Genrich (-a 10 -j -r -e chrM,chrY), excluding ENCODE blacklisted regions (ENCFF547MET.bed, downloaded from https://www.encodeproject.org/files/ENCFF547MET/). Peaks called in each sample were collated, and overlapping peaks were merged to generate a consensus list of peaks using bedtools merge. Reads per genomic content (RPGC)-normalized bigWig files were generated from bam files using the BamCoverage function in the deeptools package (v.3.0.1) with parameters --normalizeUsing RPGC --effectiveGenomeSize 2652783500 --centerReads.
RNAseq: Reads were trimmed for adapter sequences using TrimGalore (--paired --illumina --length 20). Sequences were trimmed for read quality using fastq_quality_filter in fastxtoolkit (-Q33 -q 30 -p 90). Paired-end reads were aligned to the mm10 reference genome using hisat2 (v.2.2.0) (--rna-strandness FR). Aligned reads were counted to GENCODE vM15 genomic transcripts using featureCounts in the subread package (v.1.6.2) using default parameters. Reads per genomic content (RPGC)-normalized bigWig files were generated from bam files using the BamCoverage function in the deeptools package (v.3.0.1) with parameters --normalizeUsing RPGC --effectiveGenomeSize 2652783500 --centerReads.
Genome_build: mm10 (GRCm38)
Supplementary_files_format_and_content: .tar archives include barcodes.tsv, features.tsv, and matrix.mtx files.
Supplementary_files_format_and_content: bigWig coverage files
|
| |
|
| Submission date |
Mar 16, 2021 |
| Last update date |
Nov 21, 2022 |
| Contact name |
Sofia Hu |
| E-mail(s) |
sofiahu@mit.edu, xsu@cpdr.org
|
| Organization name |
MIT
|
| Street address |
500 Main Street
|
| City |
Cambridge |
| State/province |
MA |
| ZIP/Postal code |
02139 |
| Country |
USA |
| |
|
| Platform ID |
GPL21273 |
| Series (1) |
| GSE169044 |
Transcription factor antagonism regulates heterogeneity in embryonic stem cell states |
|
| Relations |
| BioSample |
SAMN18321683 |
| SRA |
SRX10359164 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5175697_RNAseq_Klf4KO_ESC_c1_BR2.bigWig |
258.6 Mb |
(ftp)(http) |
BIGWIG |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
