GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
Sample GSM5049854 Query DataSets for GSM5049854
Status Public on Apr 19, 2022
Title PN3_smart_rep2
Sample type SRA
Source name Preimplantation embryo
Organism Mus musculus
Characteristics genotype: WT
developmental stage: PN3 stage 1-cell
molecule: polyA RNA
Extracted molecule total RNA
Extraction protocol To obtain oocytes or preimplantation embryos, 8-weeks-old or 5-weeks-old C57BL/6 female mice were intraperitoneally injected with pregnant mare’s serum gonadotropin (PMSG; 5 IU) and human chorionic gonadotrophin (hCG; 5 IU). Preimplantation embryos were collected from 5-weeks-old C57BL/39 female mice mated with PWK/PhJ male mice.
The RNA-seq libraries were generated using the Smart-seq2 protocol as described previously
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina HiSeq 1500
Data processing Ribo-lite reads were trimmed with cutadapt v1.14 with parameters: cutadapt --trim-n -a GATCGGAAGAGCACACGTCTG -a AGAGCACACGTCTG <input.file> | cutadapt -u 3 -a A{100} --no-indels -e 0.16666666666666666 - | cutadapt -O 8 --match-read-wildcards -g GTTCAGAGTTCTACAGTCCGACGATCSSS -m 18 - -o <output.file> , and the trimmed reads were sequentially mapped to mouse/human rRNAs sequences (mm9/hg19) using Bowtie2 v2.2.2 with parameters --seedlen=23. Those aligned to rRNA were discarded, and the rest reads were mapped to transcriptome of mm9/hg19 using STAR v2.5.3a with parameters --outFilterMismatchNmax 2 --outFilterMultimapNmax 20 --outFilterMatchNmin 16 --alignEndsType EndToEnd. The gene expression level was then calculated by Cufflinks v2.2.1 based on the annotation of CDS region。
All mRNA-seq data were trimmed by Trim Galore v0.4.2 then mapped to transcriptome of mm9/hg19 by STAR v2.5.3a with parameters --outFilterMultimapNmax 20 --outSAMstrandField intronMotif. The gene expression level was calculated by Cufflinks v2.2.1.
Genome_build: mm9
Submission date Jan 29, 2021
Last update date Apr 19, 2022
Contact name Zhuqing Xiong
Organization name School of Life Science, Tsinghua Univers
Street address Haidian District
City Beijing
State/province FOREIGN
ZIP/Postal code 100084
Country China
Platform ID GPL18480
Series (1)
GSE165782 Ultrasensitive Ribo-seq reveals translational landscapes during mammalian oocyte-to-embryo transition and pre-implantation development
BioSample SAMN17679186
SRA SRX9975653

Supplementary file Size Download File type/resource 16.3 Mb (ftp)(http) BW
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap