NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM5049853 Query DataSets for GSM5049853
Status Public on Apr 19, 2022
Title PN3_smart_rep1
Sample type SRA
 
Source name Preimplantation embryo
Organism Mus musculus
Characteristics genotype: WT
developmental stage: PN3 stage 1-cell
molecule: polyA RNA
Extracted molecule total RNA
Extraction protocol To obtain oocytes or preimplantation embryos, 8-weeks-old or 5-weeks-old C57BL/6 female mice were intraperitoneally injected with pregnant mare’s serum gonadotropin (PMSG; 5 IU) and human chorionic gonadotrophin (hCG; 5 IU). Preimplantation embryos were collected from 5-weeks-old C57BL/36 female mice mated with PWK/PhJ male mice.
The RNA-seq libraries were generated using the Smart-seq2 protocol as described previously
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina HiSeq 1500
 
Data processing Ribo-lite reads were trimmed with cutadapt v1.14 with parameters: cutadapt --trim-n -a GATCGGAAGAGCACACGTCTG -a AGAGCACACGTCTG <input.file> | cutadapt -u 3 -a A{100} --no-indels -e 0.16666666666666666 - | cutadapt -O 8 --match-read-wildcards -g GTTCAGAGTTCTACAGTCCGACGATCSSS -m 18 - -o <output.file> , and the trimmed reads were sequentially mapped to mouse/human rRNAs sequences (mm9/hg19) using Bowtie2 v2.2.2 with parameters --seedlen=23. Those aligned to rRNA were discarded, and the rest reads were mapped to transcriptome of mm9/hg19 using STAR v2.5.3a with parameters --outFilterMismatchNmax 2 --outFilterMultimapNmax 20 --outFilterMatchNmin 16 --alignEndsType EndToEnd. The gene expression level was then calculated by Cufflinks v2.2.1 based on the annotation of CDS region。
All mRNA-seq data were trimmed by Trim Galore v0.4.2 then mapped to transcriptome of mm9/hg19 by STAR v2.5.3a with parameters --outFilterMultimapNmax 20 --outSAMstrandField intronMotif. The gene expression level was calculated by Cufflinks v2.2.1.
Genome_build: mm9
 
Submission date Jan 29, 2021
Last update date Apr 19, 2022
Contact name Zhuqing Xiong
E-mail(s) lexizqxiong@gmail.com
Organization name School of Life Science, Tsinghua Univers
Street address Haidian District
City Beijing
State/province FOREIGN
ZIP/Postal code 100084
Country China
 
Platform ID GPL18480
Series (1)
GSE165782 Ultrasensitive Ribo-seq reveals translational landscapes during mammalian oocyte-to-embryo transition and pre-implantation development
Relations
BioSample SAMN17679188
SRA SRX9975652

Supplementary file Size Download File type/resource
GSM5049853_PN3_smart_rep1_10bp_rpkm.bw 5.5 Mb (ftp)(http) BW
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap