 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 20, 2021 |
| Title |
E12.5 inv2 distal forelimb capture Hi-C |
| Sample type |
SRA |
| |
|
| Source name |
distal forelimb
|
| Organism |
Mus musculus |
| Characteristics |
age: E12.5
strain: B6CBAF1
genotype: inv2
tissue: distal forelimb
|
| Treatment protocol |
No treatment
|
| Growth protocol |
Crosses were made between heterozygous adults. Animals were checked for vaginal plugs on the next morning, establishing the timepoint 0.5 embryonic days. Embryos were collected 12 days later.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
The forelimbs of embryos were dissected and placed into PBS with 10% FCS and 8ul collagenase at 50mg/ml (Sigma C9697) at 37º for approximately 5min. Collagenase treated samples were cross-linked with 1% formaldehyde (ThermoFisher 28908) for 10 minutes at room temperature and stored at -80º until further processing as previously described (Yakushiji-Kaminatsui et al., 2018)
Following the Hi-C protocol, ligated DNA fragments were processed throught the Agilent SureSelectXT protocol to enrich for fragments coming from the probe region chr2:72240000-76840000 (mm9).
SureSelectXT
|
| |
|
| Library strategy |
Hi-C |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
CUT and RUN reads processing was done on the Duboule local Galaxy server (Afgan et al., 2016). First, adapters were removed using cutadapt version 1.6 (Martin, 2011) with the following parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC for R1 and -a AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT for R2.
They were then processed by using hicup version 6.1.0 with the bowtie2 version 2.2.6 (Langmead and Salzberg, 2012) and SAMtools version 1.2, with mm10 as reference genome and GATC as restriction enzyme recognition sequence.
The pairs were next converted from bam to tabulated files, with the position of the middle of the fragment to which hicup assigned the read, by using an ad hoc python script (script available at https://github.com/lldelisle/scriptsForBoltEtAl2021).
Only valid pairs with both MAPQ above 30 were kept.
Then, pairs with both mates in the capture region (mm10, chr2:72402000-77000000) were extracted and processed with cooler to obtain a balance matrix of the capture region with 5-kb bins.
Genome_build: mm10
Supplementary_files_format_and_content: pairs: contains every valid pair for each dataset in the juicebox format: Each line is a pair: <readname> <str1> <chr1> <pos1> <frag1> <str2> <chr2> <pos2> <frag2> <mapq1> <mapq2> str = strand (0 for forward, anything else for reverse)
cool: contains the iced matrix in the capture region at 5kb resolution
|
| |
|
| Submission date |
Jan 25, 2021 |
| Last update date |
Jul 20, 2021 |
| Contact name |
Lucille Lopez-Delisle |
| E-mail(s) |
lucille.delisle@epfl.ch
|
| Organization name |
EPFL
|
| Street address |
Station 19
|
| City |
Lausanne |
| ZIP/Postal code |
1015 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE165491 |
Mesomelic Dysplasias Associated With The HOXD Locus Are Caused By Regulatory Reallocations [cHi-C] |
| GSE165495 |
Mesomelic Dysplasias Associated With The HOXD Locus Are Caused By Regulatory Reallocations |
|
| Relations |
| BioSample |
SAMN17531928 |
| SRA |
SRX9934236 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5034639_E12.5_inv2_DFL_CHIC.cool.gz |
3.8 Mb |
(ftp)(http) |
COOL |
| GSM5034639_E12.5_inv2_DFL_CHIC_validPairs.txt.gz |
462.3 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
