GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM5023770

Query DataSets for GSM5023770

Status

Public on Nov 15, 2021

Title

Circular 100,50

Sample type

SRA

Source name

Cell line

Organism

Homo sapiens

Characteristics

cell line: HEK293FT
treatment: Plasmid transfection

Treatment protocol

Plasmid transfection according to standard protocols.

Growth protocol

All experiments were carried out in HEK293FT cells which were grown in DMEM supplemented with 10% FBS and 1% Antibiotic-Antimycotic (Thermo Fisher) in an incubator at 37 °C and 5% CO2 atmosphere.

Extracted molecule

total RNA

Extraction protocol

RNA was extracted using the RNeasy mini kit.
RNA-seq libraries were prepared from 250ng RNA using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina NovaSeq 6000

Data processing

Basecalls were performed using Illumina RTA3, and fastq files were then generated using Illumina bcl2fastq2 v2.20. Both tasks were carried out by the UCSD IGM Genomics Center.
Sequence read pairs from stranded RNA-seq libraries were mapped to the reference human genome hg38 by running STAR aligner version 2.7.3a with the following command line options: --clip3pAdapterSeq AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (to trim Illumina adapter sequences from the 3′ ends of the reads in each pair), --quantMode GeneCounts (to collect read counts for each gene), --alignSJDBoverhangMin 1 (following ENCODE standard practice), --peOverlapNbasesMin=10 --peOverlapMMp=0.05 (to correctly align pairs of overlapping reads), --outSAMmultNmax 1 (to limit output of multimapping reads), --alignEndsType EndToEnd (to avoid soft-clipping of reads), --outFilterMismatchNmax -1 --outFilterMismatchNoverReadLmax 0.2 --outFilterMultimapNmax 1 (to increase the likelihood of successful alignment for reads containing A-to-I editing events). The genome index for STAR aligner was built using transcript annotations from Gencode release 32. Each aligned read was retained for downstream analysis even when the corresponding mate in the pair could not be successfully aligned.
Samtools version 1.10 was used to sort the aligned reads by genomic coordinate and to mark duplicated single or paired reads.
The uniquely aligned reads for each sample were down-sampled using samtools view with option -s. Down-sampling fractions were calculated by dividing the smallest number of uniquely aligned reads among all samples by the number of uniquely aligned reads available for the sample being down-sampled. Down-sampling was not performed on the reads of the control samples. To handle transcripts oriented as the forward reference strand, base counts were collected at reference A-sites using the second (first) read in a pair, if that read was mapped to the forward (reverse) reference strand. Conversely, to handle transcripts oriented as the reverse reference strand, base counts were collected at reference T-sites using the first (second) read in a pair, if that read was mapped to the forward (reverse) reference strand. The C library htslib (github.com/samtools/htslib) was used to enumerate the aligned reads that overlapped each base position in the reference genome, while avoiding double-counts of bases in regions covered by both reads in a pair. Reference sites covered by less than ten reads were ignored. The value of the SAM tag MD, “String for mismatching positions”, recorded by STAR aligner in each alignment record, was used to determine the reference base at each position of an aligned sequence read. Base deletions and insertions relative to the reference genome were ignored. Sequenced bases with a Phred quality score less than 13 were ignored. For each sample, an initial list of base counts from reads overlapping each selected reference A- and T-site was generated. The initial lists of base counts from all samples were then used to generate a final list of reference A- and T-sites where such base counts were available for all samples, and where at least one sample had a non-zero count of G (C) at reference A-sites (T-sites).
At each selected reference site in the final list, a pairwise comparison between the base counts for each treatment sample and those for the control sample was carried out using Fisher’s exact test, as implemented in R function fisher.test, with a 2-by-2 contingency table containing the counts of G (C) at reference A-sites (T-sites) in the first row, the counts of all other bases at those sites in the second row, the base counts for the control sample in the first column, and the base counts for the compared treatment sample in the second column. The resulting p-values were adjusted for multiple comparisons using the method of Benjamini and Hochberg, as implemented in R function p.adjust. The proportion of the number of G (C) bases relative to the number all bases was also calculated at each A-site (T-site). Reference A-sites (T-sites) with a significant change in such base proportion for at least one comparison between a treatment sample and the control sample were selected by requiring an adjusted p-value less than 0.01 and a fold change greater than 1.1 in either direction.
Genome_build: hg38
Supplementary_files_format_and_content: The measured base proportions for each site (row) and sample (column) are reported in processed data file pm_adar_rned_010-eadcgs_seq_rna_ed_bfscr_0_0_res-bpr-0.tsv.gz (tab separated values, compressed with gzip). The adjusted p-values for the comparison (column) of base proportion between each sample and the control sample at each site (row) are reported in processed data file pm_adar_rned_010-eadcgs_seq_rna_ed_bfscr_0_0_res-pad-0.tsv.gz (tab separated values, compressed with gzip).

Submission date

Jan 16, 2021

Last update date

Nov 15, 2021

Contact name

Dario Meluzzi

Organization name

UC San Diego

Department

School of Medicine

Lab

George Palade Laboratories 345