 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 13, 2021 |
| Title |
Control_mouse_size_matched_input |
| Sample type |
SRA |
| |
|
| Source name |
naive CD4 T cells
|
| Organism |
Mus musculus |
| Characteristics |
genotype: Rnmt fl/fl CD4cre -
Sex: Female
cell type: Naive CD4 T cells
antibody: None
|
| Treatment protocol |
CD4 T cells were suspended in PBS and exposed to 400mJ of 254nm UV then snap frozen on dry ice.
|
| Growth protocol |
CD4 T cells were sorted from control and Rnmt cKO mouse lymph nodes using an EasySep mouse CD4 T cell isolation kit.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
eCLIP was carried out essentially as described in the seCLIP protocol (Van Nostrand et al., 2017). Cells were thawed into lysis buffer (50 mM Tris-HCl pH 7.4, 100 mM NaCl, 1% NP-40 (Igepal CA630), 0.1% SDS, 0.5% sodium deoxycholate, 1:200 Protease Inhibitor Cocktail III (Sigma), 1:200 murine RNAse inhibitor (NEB)) and lysed on ice for 15 minutes. Lysates were incubated with 1µl/ml turbo DNase (Thermo Fisher Scientific) and 1µl/ml of a 1:2000 (1:1000 in test experiment) dilution of RNase1 (Thermo Fisher Scientific) in PBS for 5 mins at 37°C then returned to ice then centrifuged to remove insoluble material.
Lysates were precleared with protein G dynabeads (Thermo Fisher Scientific) at 4°C for 1hour. Lysates underwent immunoprecipitation with 50µl of protein G dynabeads preincubated with 4 µg of either LARP1, or isotype control antibody overnight at 4°C, 10% of the LARP1 samples were taken for the size matched input control. Beads were washed three times for 5 minutes with high salt wash buffer (50 mM Tris-HCl pH 7.4, 1 M NaCl, 1 mM EDTA, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate) with 2M urea. For the ProteinTech and Santa Cruz antibodies (and their isotype controls) used in the preliminary experiment a medium salt buffer (50 mM Tris-HCl pH 7.4, 600mM NaCl, 1 mM EDTA, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate) was used for these washes. RNA linker ligation was performed on bead using High concentration T4 RNA Ligase (NEB) for LARP1 and isotype libraries. RNA-protein complexes were denatured in NuPage loading buffer (Thermo Fisher Scientific) + 50mM DTT, resolved 3-8% Tris Acetate gel (Thermo Fisher Scientific) in Tris Acetate SDS buffer (Thermo Fisher Scientific), and transferred to a nitrocellulose membrane in NuPage transfer buffer (Thermo Fisher Scientific). RNA protein complexes and size matched input samples were cut from the membrane. RNA was released by incubating with Proteinase K for 20 minutes at 37°C, then with 420mg/ml urea in Proteinase K buffer for 20 minutes at 37°C and purified by phenol chloroform extraction. The RNA lnker was then ligated to the size matched input samples. All samples were reverse transcribed and ligated to a DNA linker ready for PCR amplification of libraries. Further details of the library preparation method are available in the seCLIP protocol (Van Nostrand et al., 2017).
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
seCLIP library of size matched control RNA.
Control
con_L1_pureclip_region.bed
|
| Data processing |
Libraries from the first experiment comparing antibodies were sequenced on a MiSeq with a v3 150 cycle kit in paired-end mode. Libraries from the Rnmt cKO vs. control CD4 T cell libraries were sequenced on a NextSeq 500 with a mid output v2.5 kit (150 cycles) in single end mode.
First the 10nt randomer barcode was extracted using umi_tools, then adapter sequences were trimmed from the reads using cutadapt (AGATCGGAAGAGCACACGTCTGAACTCCAGTCA). For paired end libraries only read one was used since reads were too short for the second read to be advantageous.
Reads were aligned to mm10 with gencode vM12 basic annotation using STAR 2.5.2b, then demultiplexed using umi_tools to remove PCR duplicates.
Secondary alignments and alignments with a MAPQ <20 were removed using samtools.
Bedgraph files were generated using deeptools, options -bs 10 --Offset 1 1 -of bedgraph.
Genome_build: Peaks were called using pureCLIP (Krakau et al., 2017) (options -iv 'chr1;chr2;chr3;chr4;chr5;' --mtc 10000 --ctr --dm 30) using the size matched input control for the input.
Genome_build: mm10 (GRCm38)
Supplementary_files_format_and_content: Bedgraph files have the counts of reads starting within the 10bp windows. Read start sites should be 1 nt downstream of crosslinked nucleotides so these footprints indicate areas of protein/RNA interaction in the LARP1 IP samples.
Supplementary_files_format_and_content: Bed files contain the coordinates of LARP1 binding peaks determined using PureCLIP.
|
| |
|
| Submission date |
Oct 28, 2020 |
| Last update date |
May 13, 2021 |
| Contact name |
Alison Galloway |
| E-mail(s) |
a.galloway@beatson.gla.ac.uk
|
| Organization name |
Beatson CRUK
|
| Lab |
Victoria Cowling
|
| Street address |
Garscube Estate, Switchback Road
|
| City |
Glasgow |
| ZIP/Postal code |
G61 1BD |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE160325 |
Identification of LARP1 targets in naive CD4 T cells [eCLIP] |
| GSE160328 |
RNMT regulates the CD4 T cell transcriptome and translatome |
|
| Relations |
| BioSample |
SAMN16582164 |
| SRA |
SRX9390140 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4871485_con_inp.bedgraph.gz |
31.1 Mb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
