|
| Status |
Public on Oct 26, 2020 |
| Title |
PDGFR_14W_1 |
| Sample type |
SRA |
| |
|
| Source name |
PDGFR⍺ cardiac fibroblasts
|
| Organism |
Mus musculus |
| Characteristics |
cell type: PDGFRalpha cardiac fibroblasts
strain: C57Bl/6
age: 14-week old
|
| Treatment protocol |
Cardiac fibroblasts were isolated using Flow cytometry.
|
| Growth protocol |
Hearts of 14-week-old and 1.5 year old animals were used for determination of differences in DNA methylation of either PDGFR⍺ cardiac fibroblasts isolated from those hearts or whole heart tissue.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
DNA was first extracted from whole hearts or cardiac fibroblasts (Qiagen All prep DNA/RNA mini kit, Catalog 80204).
Illumina NovaSeq SP platform (paired-end, 150bp)
|
| |
|
| Library strategy |
Bisulfite-Seq |
| Library source |
genomic |
| Library selection |
Reduced Representation |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Data processing |
Illumina BCL files files demultiplexed using bcl2fastq2v2.2.0
adapters were trimmed from demultiplexed fastq files using CutAdaptV2.4 using the following parameters; -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT --pair-filter=any -m 40
RRBS alignment index was generated using mm10 reference genome and BSBoltV0.1.2 with the following parameters; -rrbs
Trimmed fastq files aligned to human reference mm10 using BSBoltV0.1.2 using the following parameters; -BT2-k 10 -discord
Methylation calls made using BSBoltV0.1.2 using the following parameters; -min-qual 25 -min 5
Genome_build: mm10
Supplementary_files_format_and_content: Cgmap files, contain CpG sites with a minimum of 10x coverage; genomic coordinates, methylation value (0-1), number of methylated Cs and number of total Cs.
|
| |
|
| Submission date |
Oct 25, 2020 |
| Last update date |
Oct 26, 2020 |
| Contact name |
Anela Tosevska |
| E-mail(s) |
anelatosevska@gmail.com
|
| Organization name |
Medical Univrsity of Vienna
|
| Department |
Division of Rheumatology
|
| Street address |
Waehringer Guertel 18-20
|
| City |
Vienna |
| ZIP/Postal code |
1090 |
| Country |
Austria |
| |
|
| Platform ID |
GPL24247 |
| Series (2) |
| GSE160074 |
Cardiac fibroblast proliferation rates and collagen expression mature early in life and do not change with advancing age [Bisulfite-Seq] |
| GSE161079 |
Cardiac fibroblast proliferation rates and collagen expression mature early in life and do not change with advancing age |
|
| Relations |
| BioSample |
SAMN16547669 |
| SRA |
SRX9358439 |
