GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
Sample GSM4777742 Query DataSets for GSM4777742
Status Public on Sep 16, 2021
Title DEEP_br3_myod
Sample type SRA
Source name Skeletal muscle
Organism Mus musculus
Characteristics strain: C57BL/6
cell type: Freshly isoalted muscle stem cell
age: post natal day 38
genotype: Pax7Cas9
Extracted molecule genomic DNA
Extraction protocol Genomic DNA was extracted by QuickExtract (Epicentre) solution.
Genomic DNAs from AAV9-sgRNA infected satellite cells were amplified using Q5 High-Fidelity 2× Master Mix (NEB). PCR products were purified through QIAQuick PCR purification kit (Qiagen) and subjected to library preparation using NEBNext® Ultra™ II DNA Library Preparation Kit (NEB).
Library strategy OTHER
Library source genomic
Library selection other
Instrument model Illumina HiSeq 1500
Description MyoD_deep seq_rep3
Data processing Library strategy: Deep-seq
Illumina Casava1.8 software used for basecalling.
Sequenced reads were trimmed for adaptor sequence using trimmomatic v0.36 with parameter SLIDINGWINDOW:4:15 MINLEN:50, and reads without primer(Fwd:5'-AGTTAAGACGACTCTCACGG-3' and Rev:AGGCCTCATTCACTTTGCTC) are removed,then mapped to mm9 and conduct editting pattern using CRISPResso2 with parameter -w 20 --max_paired_end_reads_overlap 150 --amplicon_min_alignment_score 40 --min_identity_score 40
Genome_build: mm9
Supplementary_files_format_and_content: folder(with all CRISPResso2 output files inside)
Submission date Sep 13, 2020
Last update date Sep 16, 2021
Contact name Yingzhe Ding
Organization name The Chinese University of Hong Kong
Department Chemical Pathology
Street address Rm503,Li Ka Shing Medical Science Build.,Prince of Wales Hosp.,30-32 Ngan SHing St.
City Hong Kong
State/province Shatin NT.
ZIP/Postal code 999077
Country Hong Kong
Platform ID GPL18480
Series (2)
GSE134529 CRISPR/Cas9/AAV9-sgRNA Mediated In Vivo Genome Editing Reveals the Indispensability of Myc During Muscle Stem Cells Activation by Remodeling the 3D Chromatin
GSE157871 CRISPR/Cas9/AAV9-sgRNA Mediated In Vivo Genome Editing Reveals the Indispensability of Myc During Muscle Stem Cells Activation by Remodeling the 3D Chromatin [DEEP-seq(MyoD&Myc&Bcl6&Pknox2)]
BioSample SAMN16121593
SRA SRX9112769

Supplementary file Size Download File type/resource
GSM4777742_DEEP_MyoD_rep3.tar.gz 5.1 Mb (ftp)(http) TAR
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap