|
| Status |
Public on Dec 14, 2020 |
| Title |
AML3_day0_rep2 |
| Sample type |
SRA |
| |
|
| Source name |
AML3
|
| Organism |
Homo sapiens |
| Characteristics |
source tissue: Blood
expression: Cas9 expressing
source type: Cell line
|
| Treatment protocol |
we co-incubated the transduced AML3 cells with DNTs at a 1:1 E:T ratio for 2h to induce apoptosis in ~40-50% of the targets, depleted DNTs by magnetic separation (EasySep Human CD3 Positive Selection Kit), and performed FACS to separate Annexin V+ (live) and Annexin V- (dead or dying) target cells.
|
| Growth protocol |
AML2 and AML3 were cultured in alpha-MEM, KG1a and U937 in RPMI-1640, MV4-11 in IMDM, and TEX, all supplemented with 10% fetal bovine serum (FBS).
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Genomic DNA was extracted from replicate samples (QIAamp Blood Midi kit) and sgRNA inserts were amplified by PCR
The sgRNAs were designed using the CRISPR-DO tool that accounted for sgRNA specificity and cutting efficiency. sgRNAs were synthesized as 73-mer oligonucleotides (CustomArray, USA), GAAAGGACGAAACACCGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC (N’s denote sgRNA 20 nucleotide target sequence; sense orientation) with a total of 12,472 sequences and amplified by PCR as a pool using the following primers: TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTT GTGGAAAGGACGAAACACCG (Forward) and ACTTTTTCAAGTTGATAACG GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (Reverse). The PCR product was purified and cloned in the lentiGuide-Puro vector using BsmBI (NEB). Ligation was performed using the NEBuilder® HiFi DNA Assembly Cloning Kit and transformed into an electrocompetent strain (Stbl4; ThermoFisher, USA) to achieve ~300x coverage. Colonies were scraped off Agar plates using LB medium. Plasmid DNA was extracted using NA0310 Sigma GenElute™ HP Plasmid Maxiprep Kit and adequate library representation of each sgRNA was confirmed by NGS.
single end unstranded
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
guide RNA
AML3_D7pre_vs_D0.gene_summary.txt
|
| Data processing |
The fastq files were first converted to fasta file using custom shell script. For each sample, a custom bowtie database was generated by the command bowtie-build in bowtie suite (version 1.1.2). The library sgRNAs were mapped against the database for each sample using bowtie with the parameter v=0 and default values for other parameters.
The differential sgRNA abundance was estimated using the tool MAGeCK (Li et al., 2014).
Genome_build: Hg19
Supplementary_files_format_and_content: MAGeCK output for all cell lines. Please refer to MAGeCK documentation for output details.
|
| |
|
| Submission date |
Sep 04, 2020 |
| Last update date |
Dec 14, 2020 |
| Contact name |
Musaddeque Ahmed |
| E-mail(s) |
musaddeque.ahmed@gmail.com
|
| Organization name |
University health Network
|
| Lab |
He Lab
|
| Street address |
101 College St
|
| City |
Toronto |
| State/province |
ON |
| ZIP/Postal code |
M5G1L7 |
| Country |
Canada |
| |
|
| Platform ID |
GPL16791 |
| Series (2) |
| GSE157527 |
CRISPR screen identifies genes that sensitize AML cells to double negative T cell therapy [guide RNA] |
| GSE157618 |
CRISPR screen identifies genes that sensitize AML cells to double negative T cell therapy |
|
| Relations |
| BioSample |
SAMN16063342 |
| SRA |
SRX9078422 |
