NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4626660 Query DataSets for GSM4626660
Status Public on Aug 22, 2020
Title ChIP-seq BL-CAP-C F123 CTCF-AID WT Pol2-S2P
Sample type SRA
 
Source name mouse embryonic stem cells
Organism Mus musculus
Characteristics cell type: embyonic stem cells
cell line: F123
chip antibody: Mouse Monoclonal anti-Phospho RNA Polymerase II CTD (Ser2) (MAB Institute, Inc, MABI0602)
Treatment protocol none
Growth protocol F123 mouse embryonic stem cells were grown on gamma-irradiated mouse embryonic fibroblast cells under standard conditions (85% High Glucose DMEM, 15% Knockout Serum Replacement, 0.1 mM non-essential amino acids, 0.1 mM β-mercaptoethanol, 1 mM Glutamine, LIF 500U/mL, +P/S). Before harvesting for CAP-C; ChIP-Seq; PLAC-Seq or in-situ Hi-C, F123 mESCs were passaged onto feeder free 0.2% gelatin coated plates for at least 2 passages to rid the culture of feeder cells.
Extracted molecule genomic DNA
Extraction protocol For all ChIP-Seq experiment, after formaldehyde crosslinking, chromatins were sheared by sonication and DNA bound with protein of interest was enriched by antibodies. DNA protein complexes were revese crosslinked and extracted by phenol:chloroform.
DNA was end-repaired using a combination of T4 DNA polymerase, E. coli DNA Pol I large fragment (Klenow polymerase) and T4 polynucleotide kinase. The blunt, phosphorylated ends were treated with Klenow fragment ( exo minus) and dATP to yield a protruding 3- 'A' base for ligation of Illumina's adapters which have a single 'T' base overhang at the 3’ end. After adapter ligation, DNA was PCR amplified with Illumina primers for 11 cycles and library fragments of ~300 bp (insert plus adaptor and PCR primer sequences) were band isolated from an agarose gel. The purified DNA was captured on an Illumina flow cell for cluster generation. Libraries were sequenced on the Genome Analyzer following the manufacturer's protocols.
 
Library strategy ChIP-Seq
Library source genomic
Library selection ChIP
Instrument model Illumina NextSeq 500
 
Data processing CAP-C, BL-CAP-C, in-situ Hi-C and PLAC-seq: Each read end sequenced from the proximity ligated libraries was aligned independently to either the mm10, hg19 or dm3 reference genome using BWA-MEM (v 0.7.12). Singletons and chimeric reads were removed. PCR duplicates, unligated reads and reads with a contact distance less than 1Kb were also filtered. PCR duplicates were removed using Picard Tools (v 2.2.2). Unligated reads were defined as both read ends mapping onto the same MboI fragment. A pre-formatted text file was prepared before converting it into a .hic format file with the following resolutions (0.5 Kb, 1 Kb, 2 Kb, 5 Kb, 10 Kb, 25 Kb, 40 Kb, 50 Kb, 100 Kb, 250 Kb, 500 Kb, 1 Mb and 2.5 Mb). Finally, a MAPQ>=1 and MAPQ>=30 .hic file was then generated for each sample. To generate a CAP-C merge file, all G3, G5 and G7 primary and replicated libraries in the pre-formatted text file were concatenated and merged-sorted before using Juicer Tools (v 0.7.0) to convert it into a .hic formatted file.
BL-CAP-C: For DNase I fragmentation-based libraries, we have additional pre-processing steps to be performed prior to the instructions listed in the CAP-C data processing section listed above. We first used SeqPrep to merge overlapping read pairs (2×150 bp). For the resulting merged and unmerged read pairs, cutadapt was used to trim the bridge linker adaptor (ACGCGATATCTTATCTGACT, both forward and reverse-complementary) off the read from the 5’ (-g) and 3’ (-a) direction. Up to 1 adaptor count per read (-n) was used, and a minimum overlap length of 10 threshold (--overlap) between the linker and read was used. Only read pairs where the length of at least one read was too short (<15bp) or merged read pairs that failed to possess a linker were removed (Supplementary Table 2). Because DNase I was used to fragment BL-CAP-C datasets, no restriction cut site annotation files was done to annotate the paired reads.
CAP-C, BL-CAP-C and in-situ Hi-C: Compartments were called using the Eigenvector module of Juicer (v 0.7.0). Peaks/Loops were called using HiCCUPs. Domains were called using Arrowhead. Strength around the ends of the domain boundary or a region of interest was measured by computing the values of the directionality index metric. Aggregate Peak Analysis (APA) was performed on low-resolution contact maps using the APA module of Juicer.
ChIP-seq: ChIP-seq libraries were aligned to the mm10 or hg19 reference genome using BWA-MEM (v 0.7.12). PCR duplicates were removed using Picard Tools (v 2.2.2). Peak calling was performed using MACS2 (Zhang et al.) with both treated and control BAM files, or just the IP sample alone using the following parameters: -q 0.05 –f BAM (–g mm | -g hs). We used bedtools (v 2.27) to create bedGraph files of depth-normalized RPM or FPM values before converting them to bigWig files using UCSC bedGraphToBigWig.
Genome_build: mm10,hg19,dm3
Supplementary_files_format_and_content: Merged primary and replicate samples are labeled with a B0* instead of an S0* or R0*.
 
Submission date Jun 18, 2020
Last update date Aug 24, 2020
Contact name Youzhi Cheng
Organization name University of Connecticut Health Center
Department Genetics and Genome Sciences
Street address 400 Farmington Avenue
City Farmington
State/province Connecticut
ZIP/Postal code 06032
Country USA
 
Platform ID GPL19057
Series (1)
GSE110061 Direct DNA crosslinking with CAP-C uncovers transcription-dependent chromatin organization at high resolution
Relations
BioSample SAMN15325468
SRA SRX8582164

Supplementary file Size Download File type/resource
GSM4626660_G5_BLCAPC-CTCF-AID-WT_Pol2-S2P_R01.bigWig 252.1 Mb (ftp)(http) BIGWIG
GSM4626660_G5_BLCAPC-CTCF-AID-WT_Pol2-S2P_R01_peaks.narrowPeak.gz 413.0 Kb (ftp)(http) NARROWPEAK
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap