 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Aug 22, 2020 |
| Title |
BL-CAP-C HepG2 G7 rep2 |
| Sample type |
SRA |
| |
|
| Source name |
human kidney cells
|
| Organism |
Homo sapiens |
| Characteristics |
cell type: kidney cells
cell line: HepG2
chip antibody: none
|
| Treatment protocol |
none
|
| Growth protocol |
F123 mouse embryonic stem cells were grown on gamma-irradiated mouse embryonic fibroblast cells under standard conditions (85% High Glucose DMEM, 15% Knockout Serum Replacement, 0.1 mM non-essential amino acids, 0.1 mM β-mercaptoethanol, 1 mM Glutamine, LIF 500U/mL, +P/S). Before harvesting for CAP-C; ChIP-Seq; PLAC-Seq or in-situ Hi-C, F123 mESCs were passaged onto feeder free 0.2% gelatin coated plates for at least 2 passages to rid the culture of feeder cells.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
For all CAP-C experiment, after dendrimer crosslinking, DNA bound protein was striped away by proteinase K and DNA was extracted by ethanol precopitation.
DNA was end-repaired using a combination of T4 DNA polymerase, E. coli DNA Pol I large fragment (Klenow polymerase) and T4 polynucleotide kinase. The blunt, phosphorylated ends were treated with Klenow fragment ( exo minus) and dATP to yield a protruding 3- 'A' base for ligation of Illumina's adapters which have a single 'T' base overhang at the 3’ end. After adapter ligation, DNA was PCR amplified with Illumina primers for 11 cycles and library fragments of ~300 bp (insert plus adaptor and PCR primer sequences) were band isolated from an agarose gel. The purified DNA was captured on an Illumina flow cell for cluster generation. Libraries were sequenced on the Genome Analyzer following the manufacturer's protocols.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Data processing |
Library strategy: BL-CAP-C
CAP-C, BL-CAP-C, in-situ Hi-C and PLAC-seq: Each read end sequenced from the proximity ligated libraries was aligned independently to either the mm10, hg19 or dm3 reference genome using BWA-MEM (v 0.7.12). Singletons and chimeric reads were removed. PCR duplicates, unligated reads and reads with a contact distance less than 1Kb were also filtered. PCR duplicates were removed using Picard Tools (v 2.2.2). Unligated reads were defined as both read ends mapping onto the same MboI fragment. A pre-formatted text file was prepared before converting it into a .hic format file with the following resolutions (0.5 Kb, 1 Kb, 2 Kb, 5 Kb, 10 Kb, 25 Kb, 40 Kb, 50 Kb, 100 Kb, 250 Kb, 500 Kb, 1 Mb and 2.5 Mb). Finally, a MAPQ>=1 and MAPQ>=30 .hic file was then generated for each sample. To generate a CAP-C merge file, all G3, G5 and G7 primary and replicated libraries in the pre-formatted text file were concatenated and merged-sorted before using Juicer Tools (v 0.7.0) to convert it into a .hic formatted file.
BL-CAP-C: For DNase I fragmentation-based libraries, we have additional pre-processing steps to be performed prior to the instructions listed in the CAP-C data processing section listed above. We first used SeqPrep to merge overlapping read pairs (2×150 bp). For the resulting merged and unmerged read pairs, cutadapt was used to trim the bridge linker adaptor (ACGCGATATCTTATCTGACT, both forward and reverse-complementary) off the read from the 5’ (-g) and 3’ (-a) direction. Up to 1 adaptor count per read (-n) was used, and a minimum overlap length of 10 threshold (--overlap) between the linker and read was used. Only read pairs where the length of at least one read was too short (<15bp) or merged read pairs that failed to possess a linker were removed (Supplementary Table 2). Because DNase I was used to fragment BL-CAP-C datasets, no restriction cut site annotation files was done to annotate the paired reads.
CAP-C, BL-CAP-C and in-situ Hi-C: Compartments were called using the Eigenvector module of Juicer (v 0.7.0). Peaks/Loops were called using HiCCUPs. Domains were called using Arrowhead. Strength around the ends of the domain boundary or a region of interest was measured by computing the values of the directionality index metric. Aggregate Peak Analysis (APA) was performed on low-resolution contact maps using the APA module of Juicer.
ChIP-seq: ChIP-seq libraries were aligned to the mm10 or hg19 reference genome using BWA-MEM (v 0.7.12). PCR duplicates were removed using Picard Tools (v 2.2.2). Peak calling was performed using MACS2 (Zhang et al.) with both treated and control BAM files, or just the IP sample alone using the following parameters: -q 0.05 –f BAM (–g mm | -g hs). We used bedtools (v 2.27) to create bedGraph files of depth-normalized RPM or FPM values before converting them to bigWig files using UCSC bedGraphToBigWig.
Genome_build: mm10,hg19,dm3
Supplementary_files_format_and_content: Merged primary and replicate samples are labeled with a B0* instead of an S0* or R0*.
|
| |
|
| Submission date |
Jun 18, 2020 |
| Last update date |
Aug 24, 2020 |
| Contact name |
Youzhi Cheng |
| Organization name |
University of Connecticut Health Center
|
| Department |
Genetics and Genome Sciences
|
| Street address |
400 Farmington Avenue
|
| City |
Farmington |
| State/province |
Connecticut |
| ZIP/Postal code |
06032 |
| Country |
USA |
| |
|
| Platform ID |
GPL24676 |
| Series (1) |
| GSE110061 |
Direct DNA crosslinking with CAP-C uncovers transcription-dependent chromatin organization at high resolution |
|
| Relations |
| BioSample |
SAMN15325400 |
| SRA |
SRX8582122 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4626618_G7_BLCAPC-HepG2_R06_MAPQ1.hic |
4.5 Gb |
(ftp)(http) |
HIC |
| GSM4626618_G7_BLCAPC-HepG2_R06_MAPQ30.hic |
4.1 Gb |
(ftp)(http) |
HIC |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
