NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM462214 Query DataSets for GSM462214
Status Public on Feb 16, 2010
Title dcr1DeltaC33
Sample type SRA
 
Source name dcr1DeltaC33
Organism Schizosaccharomyces pombe
Characteristics strain: SPB287
Extracted molecule total RNA
Extraction protocol Total RNA was isolated from cells harvested at OD600=0.5 using the hot phenol method (Leeds, 1991) and subjected to size fractionation using RNeasy Midi columns (QIAGEN) as previously described (Buhler, 2006). 17-30nt small RNAs were PAGE purified and were cloned based upon the preactivated, adenylated linkering method described previously (Lau, 2001) using a mutant T4 RNA ligase (Rnl21-249) (Ho, 2004). Bar coded linkers suitable for Solexa sequencing were used for multiplexing and sequencing using an Illumina Genome Analyzer 2 (GA2).
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina Genome Analyzer II
 
Description Schizosaccharomyces pombe small RNA library from total RNA isolations, barcode 5' AGGC, 3' TCGTATGCCGTCTTCTGCTTG
Data processing All samples were barcoded at the 3'end of the 5'adapter using a hamming distance two code with a 3' cytosine (AAAC,ACCC,AGGC,ATTC,CACC,CCGC,CGTC,CTAC,GAGC,GCTC,GGAC,GTCC,TATC,TCAC,TGCC,TTGC) and sequenced (with other samples) in one lane of an Illumina GA2 instrument. Individual reads were assigned to their sample based on the first 4 nucleotides containing the barcode. The 3' adapter was removed by aligning it to the read allowing one or two mismatches in prefix alignments of at least 7 or 10 bases respectively. Low complexity reads were filtered out based on their dinucleotide entropy (removing <1% of the reads). All the reads that were shorter than 14 nucleotides were removed.
 
Submission date Oct 15, 2009
Last update date May 15, 2019
Contact name Dimos Gaidatzis
E-mail(s) d.gaidatzis@fmi.ch
Organization name Friedrich Miescher Institute
Street address Maulbeerstrasse 66
City Basel
ZIP/Postal code 4058
Country Switzerland
 
Platform ID GPL9453
Series (1)
GSE18582 Nuclear retention of fission yeast dicer is a prerequisite for RNAi-mediated heterochromatin assembly
Relations
SRA SRX016554
BioSample SAMN00008672

Supplementary file Size Download File type/resource
GSM462214_03_dcrC33.tab.gz 1.1 Mb (ftp)(http) TAB
SRA Run SelectorHelp
Processed data provided as supplementary file
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap