|
| Status |
Public on Sep 16, 2020 |
| Title |
Untreated_OVCAR8_Day4 |
| Sample type |
SRA |
| |
|
| Source name |
OVCAR8
|
| Organism |
Homo sapiens |
| Characteristics |
treatment: untreated
cell line: OVCAR8
|
| Treatment protocol |
315×10^6 OVCAR8 cells were transduced with a pooled genome-wide lentiviral sgRNA library in a Cas9-containing vector34–36 (Addgene #1000000100) at MOI < 1. Stably transduced cells were selected with 2 μg/ml puromycin, and 240×10^6 cells were passaged every 48-72 hours at a density of 3×10^6 cells/15 cm dish in Ovcar8 growth medium for the duration of the screen. At 6 weeks post-puromycin selection, 360×10^6 cells were treated with escalating doses of RSL3 (Selleckchem) for 4 days each: 0.5 μM, 1 μM, and 2μM. 1×10^7 cells each were collected from the surviving population of RSL3-treated cells and an endpoint-matched untreated population for sequencing analysis.
|
| Growth protocol |
OVCAR-8 cells (obtained from the laboratory of Joan Brugge; Harvard Medical School), were cultured in growth media composed of 1:1 MCDB 105 media (Sigma) / Medium 199 Eagles media (Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin/streptomycin (Sigma), in a humidified incubator at 37 °C with 5% CO2. Human cell line authentication (CLA) analysis of OVCAR-8 cells were performed prior to screening by Duke University DNA Analysis facility. Cells tested negative for mycoplasma contamination.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Genomic DNA was isolated using a QiAmp DNA blood extraction kit.
Libraries were prepared as in: Wang T, Lander ES, & Sabatini DM (2016) Viral Packaging and Cell Culture for CRISPR-based Screens. Cold Spring Harb Protoc 2016(3): pdb.prot090811 PMID: 26933250, with the following exceptions: Forward PCR primer: AATGATACGGCGACCACCGAGATCTACACGAATACTGCCATTTGTCTCAAGATCTA DNA Polymerase: ExTaq (Takara) Genomic DNA/50 μL PCR reaction: 6 μg Amplification cycles: 28
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
CRISPR amplicon
|
| Data processing |
Library strategy: custom (CRISPR amplicon)
Base calls were performed by the HiSeq instrument control software and further processed using the Offline Base Caller (Illumina) v. 1.9.4.
The reverse complement of the first 20 nucleotides of each fastq read was searched against a file of reference sgRNA referene sequences (available on Addgene: Human Activity-Optimized CRISPR Knockout Library # 1000000100) and each match was counted.
Supplementary_files_format_and_content: counts
|
| |
|
| Submission date |
May 22, 2020 |
| Last update date |
Sep 17, 2020 |
| Contact name |
Yilong Zou |
| E-mail(s) |
yzou@broadinstitute.org
|
| Organization name |
Broad Institute of MIT and Harvard
|
| Department |
Chemical Biology and Therapeutic Sciences
|
| Street address |
415 Main Street
|
| City |
Cambridge |
| State/province |
MASSACHUSETTS |
| ZIP/Postal code |
02142 |
| Country |
USA |
| |
|
| Platform ID |
GPL16791 |
| Series (1) |
| GSE151062 |
Plasticity of ether lipids promotes ferroptosis susceptibility and evasion |
|
| Relations |
| BioSample |
SAMN14998425 |
| SRA |
SRX8382023 |
