|
| Status |
Public on Jul 23, 2020 |
| Title |
DNA_v_RNA_DNACC |
| Sample type |
SRA |
| |
|
| Source name |
HCT-116
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HCT-116
tissue: colorectal cancer
|
| Treatment protocol |
Approximately 500,000 HCT-116 cells were plated in a single well of a 6-well plate. Cells were transfected with 2.5 µg of the SP1-PBase plasmid and 2.5 µg of the PB-SRT-Puro plasmid using Lipofectamine 3000 following manufacturer’s instructions. After 24 hours, cells were split and plated 1:10 in each of three 10 cm dishes. Puromycin was then added to a final concentration of 2 µg/ml and colonies were grown under selection for two weeks. We obtained approximately 2,300 colonies. All cells were pooled together and split into two populations. One half was subjected to DNA extraction, self-ligation, and inverse PCR, as described previously (Wang et al., 2012a), with the following modification: digestion with MspI was not performed as the SRT construct contained an second MspI cut site near the terminal repeat. The other half of cells underwent RNA extraction and SRT library preparation.
|
| Growth protocol |
Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% of either penicillin-streptomycin or antibiotic-antimycotic. Cells were grown at 37ºC with 5% carbon dioxide (CO2). Media was replenished every 2 days.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
DNA extraction was performed as described previously (Wang et al., 2012a)
Self-ligation of digested genomic DNA and inverse PCR was performed as described previously (Wang et al., 2012a), with the following modification: digestion with MspI was not performed as the SRT construct contained an second MspI cut site near the terminal repeat.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
Bulk DNA calling cards library
|
| Data processing |
Reads were demultiplexed by the 3 base-pair barcode TAG followed by the end of the transposon terminal repeat, culminating with the piggyBac insertion site motif TTAA. Reads that had exact matches to these sequences were hard trimmed using cutadapt (Martin, 2011) with the following settings: -g "^TAGTTTACGCAGACTATCTTTCTAGGGTTAA" --minimum-length 1 --discard-untrimmed -e 0 --no-indels. Reads passing this filter were then trimmed of vector sequence along read 2 using cutadapt with the following settings: -g "^ATCACTTAAGCCGGTAC"" --minimum-length 1 --discard-untrimmed -e 0 --no-indels. The remaining reads were aligned to the human genome (build hg38) with NovoAlign and the following settings: -n 40 -o SAM -o SoftClip. Aligned reads were validated by confirming that they mapped adjacent to the insertion site motif. Successful reads were then converted to calling card format (.ccf.txt; see http://wiki.wubrowse.org/Calling_card) using custom programs (available at https://github.com/arnavm/calling_cards) and visualized on the WashU Epigenome Browser v46 (Zhou et al., 2011) (http://epigenomegateway.wustl.edu/legacy/).
Genome_build: hg38
Supplementary_files_format_and_content: Supplementary_files_format_and_content: BAM files contain aligned and annotated calling card reads. ccf.txt files contain processed calling card data. describes calling card-specific BAM tags.
|
| |
|
| Submission date |
Apr 10, 2020 |
| Last update date |
Jul 23, 2020 |
| Contact name |
Robi D Mitra |
| E-mail(s) |
rmitra@wustl.edu
|
| Organization name |
Washington University in St. Louis
|
| Department |
Genetics
|
| Street address |
4515 McKinley Ave
|
| City |
St. Louis |
| State/province |
Missouri |
| ZIP/Postal code |
63143 |
| Country |
USA |
| |
|
| Platform ID |
GPL18573 |
| Series (1) |
| GSE148448 |
Self-reporting transposons enable simultaneous readout of gene expression and transcription factor binding in single cells |
|
| Relations |
| BioSample |
SAMN14573307 |
| SRA |
SRX8094399 |
