|
Status |
Public on Sep 01, 2020 |
Title |
15580X4 Cornea rep4 |
Sample type |
SRA |
|
|
Source name |
Corneal Endothelium
|
Organism |
Mus musculus |
Characteristics |
strain: C57BL/6 tissue: Corneal Endothelium
|
Treatment protocol |
Intracameral injection of Ad-Cas9-Col8a2gRNA
|
Extracted molecule |
genomic DNA |
Extraction protocol |
Genomic DNA from the corneal endothelium/stroma was purified by Quick-DNA Microprep Plus Kit (Zymo research). PCRs were performed on the locus using TTCTTCTTCTCCCTGCAGCC and GCACATACTTTACCGGGGCA (30 cycles, the product size: 155bp). The deep sequencing was performed by the HSC core at University of Utah. The library was prepared using the Swift Biosciences Accel-NGS 1S Plus DNA Library Kit. The sequence protocol used MiSeq Nano 150 Cycle Paired End Sequencing v2.
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
Illumina MiSeq |
|
|
Description |
One month post Ad-Cas9-Col8a2gRNA injection
|
Data processing |
Fastq files were loaded into Galaxy (https://galaxyproject.org/). The sequences having CTTCTCCCTG and CTGCCTTCGC were extracted using the Select feature, The number of bases between CTTCTCCCTG and CTGCCTTCGC were counted. Genome_build: GRCm38 Supplementary_files_format_and_content: 15580R_IndelRate_MsCornealEndothelium.xlsx
|
|
|
Submission date |
Mar 15, 2020 |
Last update date |
Sep 01, 2020 |
Contact name |
Hironori Uehara |
E-mail(s) |
uhironori_0916@yahoo.co.jp
|
Organization name |
Loma Linda University
|
Department |
Ophthalmology
|
Lab |
Ambati lab
|
Street address |
11021 Campus st
|
City |
Loma Linda |
State/province |
California |
ZIP/Postal code |
92350 |
Country |
USA |
|
|
Platform ID |
GPL16417 |
Series (2) |
GSE146998 |
Indel rate analysis:Start codon disruption with CRISPR/Cas9 prevents murine Fuchs' endothelial corneal dystrophy |
GSE146999 |
Start codon disruption with CRISPR/Cas9 prevents murine Fuchs' endothelial corneal dystrophy |
|
Relations |
BioSample |
SAMN14380121 |
SRA |
SRX7913594 |