|
| Status |
Public on Sep 01, 2020 |
| Title |
15580X3 Cornea rep3 |
| Sample type |
SRA |
| |
|
| Source name |
Corneal Endothelium
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL/6
tissue: Corneal Endothelium
|
| Treatment protocol |
Intracameral injection of Ad-Cas9-Col8a2gRNA
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Genomic DNA from the corneal endothelium/stroma was purified by Quick-DNA Microprep Plus Kit (Zymo research).
PCRs were performed on the locus using TTCTTCTTCTCCCTGCAGCC and GCACATACTTTACCGGGGCA (30 cycles, the product size: 155bp). The deep sequencing was performed by the HSC core at University of Utah. The library was prepared using the Swift Biosciences Accel-NGS 1S Plus DNA Library Kit.
The sequence protocol used MiSeq Nano 150 Cycle Paired End Sequencing v2.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Description |
One month post Ad-Cas9-Col8a2gRNA injection
|
| Data processing |
Fastq files were loaded into Galaxy (https://galaxyproject.org/).
The sequences having CTTCTCCCTG and CTGCCTTCGC were extracted using the Select feature,
The number of bases between CTTCTCCCTG and CTGCCTTCGC were counted.
Genome_build: GRCm38
Supplementary_files_format_and_content: 15580R_IndelRate_MsCornealEndothelium.xlsx
|
| |
|
| Submission date |
Mar 15, 2020 |
| Last update date |
Sep 01, 2020 |
| Contact name |
Hironori Uehara |
| E-mail(s) |
uhironori_0916@yahoo.co.jp
|
| Organization name |
Loma Linda University
|
| Department |
Ophthalmology
|
| Lab |
Ambati lab
|
| Street address |
11021 Campus st
|
| City |
Loma Linda |
| State/province |
California |
| ZIP/Postal code |
92350 |
| Country |
USA |
| |
|
| Platform ID |
GPL16417 |
| Series (2) |
| GSE146998 |
Indel rate analysis:Start codon disruption with CRISPR/Cas9 prevents murine Fuchs' endothelial corneal dystrophy |
| GSE146999 |
Start codon disruption with CRISPR/Cas9 prevents murine Fuchs' endothelial corneal dystrophy |
|
| Relations |
| BioSample |
SAMN14380122 |
| SRA |
SRX7913597 |
