NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4411938 Query DataSets for GSM4411938
Status Public on Sep 01, 2020
Title 15580X1 Cornea rep1
Sample type SRA
 
Source name Corneal Endothelium
Organism Mus musculus
Characteristics strain: C57BL/6
tissue: Corneal Endothelium
Treatment protocol Intracameral injection of Ad-Cas9-Col8a2gRNA
Extracted molecule genomic DNA
Extraction protocol Genomic DNA from the corneal endothelium/stroma was purified by Quick-DNA Microprep Plus Kit (Zymo research).
PCRs were performed on the locus using TTCTTCTTCTCCCTGCAGCC and GCACATACTTTACCGGGGCA (30 cycles, the product size: 155bp). The deep sequencing was performed by the HSC core at University of Utah. The library was prepared using the Swift Biosciences Accel-NGS 1S Plus DNA Library Kit.
The sequence protocol used MiSeq Nano 150 Cycle Paired End Sequencing v2.
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model Illumina MiSeq
 
Description One month post Ad-Cas9-Col8a2gRNA injection
Data processing Fastq files were loaded into Galaxy (https://galaxyproject.org/).
The sequences having CTTCTCCCTG and CTGCCTTCGC were extracted using the Select feature,
The number of bases between CTTCTCCCTG and CTGCCTTCGC were counted.
Genome_build: GRCm38
Supplementary_files_format_and_content: 15580R_IndelRate_MsCornealEndothelium.xlsx
 
Submission date Mar 15, 2020
Last update date Sep 01, 2020
Contact name Hironori Uehara
E-mail(s) uhironori_0916@yahoo.co.jp
Organization name Loma Linda University
Department Ophthalmology
Lab Ambati lab
Street address 11021 Campus st
City Loma Linda
State/province California
ZIP/Postal code 92350
Country USA
 
Platform ID GPL16417
Series (2)
GSE146998 Indel rate analysis:Start codon disruption with CRISPR/Cas9 prevents murine Fuchs' endothelial corneal dystrophy
GSE146999 Start codon disruption with CRISPR/Cas9 prevents murine Fuchs' endothelial corneal dystrophy
Relations
BioSample SAMN14380124
SRA SRX7913595

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap