NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4294453 Query DataSets for GSM4294453
Status Public on Feb 05, 2020
Title AtopicW5
Sample type SRA
 
Source name peripheral blood
Organism Canis lupus familiaris
Characteristics tissue: PBMCs
allergy status: atopic dermatitis
breed: West Highland White Terrier
Sex: female
age (years): 8
Extracted molecule total RNA
Extraction protocol Drop-seq protocol provided online by MacCarroll lab (version 3.1, 12/28/2015)
Nextera XT Library Preparation Kit
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NextSeq 500
 
Data processing Drop-seq Core Computation Protocol (version 2.0.0, 9/28/18) with Drop-seq_tools-1-12; Default pipeline and settings unless noted otherwise.
FastqToSam (Picard-tools-2.8.2)
TagBamWithReadSequenceExtended (BASE_RANGE= 1-12, BASE_QUALITY= 10, BARCODED_READ= 1, DISCARD_READ= False, TAG_NAME= XC, NUM_BASES_BELOW_QUALITY= 1)
TagBamWithReadSequenceExtended (BASE_RANGE= 13-20, BASE_QUALITY= 10, BARCODED_READ= 1, DISCARD_READ= True, TAG_NAME= XM, NUM_BASES_BELOW_QUALITY= 1)
FilterBAM (TAG_REJECT= Q)
TrimStartingSequence (SEQUENCE= AAGCAGTGGTATCAACGCAGAGTGAATGGG, MISMATCHES=0, NUM_BASES= 5)
SamToFastq (Picard-tools-2.8.2)
STAR-2.7.0f alignment with CanFam3.1 and CanFam3.1.96 from ensembl
SortSam (SO= queryname) (Picard-tools-2.8.2)
MergeBamAlignment (INCLUDE_SECONDARY_ALIGNMENT= false, PAIRED_RUN= false) (Picard-tools-2.8.2)
TagReadWithGeneExon (TAG= GE)
DigitalExpression (MIN_NUM_GENES_PER_CELL= 10)
Genome_build: CanFam3.1 and CanFam3.1.96 from ensembl
Supplementary_files_format_and_content: .txt (single-cell digital gene expression matrix)
 
Submission date Feb 04, 2020
Last update date Feb 05, 2020
Contact name Elia Tait Wojno
Organization name University of Washington
Department Department of Immunology
Lab Tait Wojno lab
Street address 750 Republican St.
City Seattle
State/province WA
ZIP/Postal code 98109
Country USA
 
Platform ID GPL21400
Series (1)
GSE144730 Single-cell RNA sequencing quantitative analysis of PBMC transcriptomes from dogs with atopic dermatitis and healthy dogs
Relations
BioSample SAMN13979605
SRA SRX7670261

Supplementary file Size Download File type/resource
GSM4294453_AtopicW5_gene_exon_tagged.dge.txt.gz 7.0 Mb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap