 |
 |
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Feb 05, 2020 |
Title |
AtopicW4 |
Sample type |
SRA |
|
|
Source name |
peripheral blood
|
Organism |
Canis lupus familiaris |
Characteristics |
tissue: PBMCs allergy status: atopic dermatitis breed: West Highland White Terrier Sex: male age (years): 7
|
Extracted molecule |
total RNA |
Extraction protocol |
Drop-seq protocol provided online by MacCarroll lab (version 3.1, 12/28/2015) Nextera XT Library Preparation Kit
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NextSeq 500 |
|
|
Data processing |
Drop-seq Core Computation Protocol (version 2.0.0, 9/28/18) with Drop-seq_tools-1-12; Default pipeline and settings unless noted otherwise. FastqToSam (Picard-tools-2.8.2) TagBamWithReadSequenceExtended (BASE_RANGE= 1-12, BASE_QUALITY= 10, BARCODED_READ= 1, DISCARD_READ= False, TAG_NAME= XC, NUM_BASES_BELOW_QUALITY= 1) TagBamWithReadSequenceExtended (BASE_RANGE= 13-20, BASE_QUALITY= 10, BARCODED_READ= 1, DISCARD_READ= True, TAG_NAME= XM, NUM_BASES_BELOW_QUALITY= 1) FilterBAM (TAG_REJECT= Q) TrimStartingSequence (SEQUENCE= AAGCAGTGGTATCAACGCAGAGTGAATGGG, MISMATCHES=0, NUM_BASES= 5) SamToFastq (Picard-tools-2.8.2) STAR-2.7.0f alignment with CanFam3.1 and CanFam3.1.96 from ensembl SortSam (SO= queryname) (Picard-tools-2.8.2) MergeBamAlignment (INCLUDE_SECONDARY_ALIGNMENT= false, PAIRED_RUN= false) (Picard-tools-2.8.2) TagReadWithGeneExon (TAG= GE) DigitalExpression (MIN_NUM_GENES_PER_CELL= 10) Genome_build: CanFam3.1 and CanFam3.1.96 from ensembl Supplementary_files_format_and_content: .txt (single-cell digital gene expression matrix)
|
|
|
Submission date |
Feb 04, 2020 |
Last update date |
Feb 05, 2020 |
Contact name |
Elia Tait Wojno |
Organization name |
University of Washington
|
Department |
Department of Immunology
|
Lab |
Tait Wojno lab
|
Street address |
750 Republican St.
|
City |
Seattle |
State/province |
WA |
ZIP/Postal code |
98109 |
Country |
USA |
|
|
Platform ID |
GPL21400 |
Series (1) |
GSE144730 |
Single-cell RNA sequencing quantitative analysis of PBMC transcriptomes from dogs with atopic dermatitis and healthy dogs |
|
Relations |
BioSample |
SAMN13979606 |
SRA |
SRX7670260 |
Supplementary file |
Size |
Download |
File type/resource |
GSM4294452_AtopicW4_gene_exon_tagged.dge.txt.gz |
3.5 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
 |