NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4237688 Query DataSets for GSM4237688
Status Public on Dec 28, 2019
Title Ago.CLIP_BAT_8t
Sample type SRA
 
Source name interscapular brown adipose tissue
Organism Mus musculus
Characteristics strain: C57BL/6J
tissue: interscapular brown adipose tissue
pooling: 2 mice per replicate
age: 15 week
Extracted molecule total RNA
Extraction protocol Tissues were UV-irradiated and subjected to Ago-CLIP with mouse anti-Ago (citation), clone INSERT (detailed desription in accompanying paper).
partial RNAse digestion, RNA linker ligation and PCR amplificiation. Ago-bound fragments were ligated to a degenerate 3'linker.
 
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model Illumina MiSeq
 
Data processing Library strategy: CLIP-seq
collapsing of exact sequences
stripping of degenerate linker (5nt; ends with a G)
removal of 3'adaptor (GTGTCAGTCACTTCCAGCGG)
alignment with novoalign (unambiguous mapping on mm10)
collapsing of PCR duplicates (unique CLIP tags)
clustering of unique reads
Genome_build: Genome_build: mm10
Supplementary_files_format_and_content: bedgraph files generated from Ago-CLIP unique tags for genome browser
 
Submission date Dec 27, 2019
Last update date Dec 30, 2019
Contact name Sean O'Connor
E-mail(s) soconnor@rockefeller.edu
Organization name Rockefeller University
Department Laboratory of Molecular Metabolism
Lab Paul Cohen
Street address 1230 York Ave
City New York
State/province NY
ZIP/Postal code 10065
Country USA
 
Platform ID GPL16417
Series (1)
GSE142677 AGO HITS-CLIP Reveals Distinct Patterns of miRNA Regulation of Visceral and Brown Adipose Tissue Identity
Relations
BioSample SAMN13691130
SRA SRX7450756

Supplementary file Size Download File type/resource
GSM4237688_Ago.CLIP_BAT_8t.tag.uniq.bedgraph.gz 3.3 Mb (ftp)(http) BEDGRAPH
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap