GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
Sample GSM4237683 Query DataSets for GSM4237683
Status Public on Dec 28, 2019
Title Ago.CLIP_WAT_3t
Sample type SRA
Source name epididymal white adipose tissue
Organism Mus musculus
Characteristics strain: C57BL/6J
tissue: epididymal white adipose tissue
pooling: 2 mice per replicate
age: 15 week
Extracted molecule total RNA
Extraction protocol Tissues were UV-irradiated and subjected to Ago-CLIP with mouse anti-Ago (citation), clone INSERT (detailed desription in accompanying paper).
partial RNAse digestion, RNA linker ligation and PCR amplificiation. Ago-bound fragments were ligated to a degenerate 3'linker.
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model Illumina MiSeq
Data processing Library strategy: CLIP-seq
collapsing of exact sequences
stripping of degenerate linker (5nt; ends with a G)
removal of 3'adaptor (GTGTCAGTCACTTCCAGCGG)
alignment with novoalign (unambiguous mapping on mm10)
collapsing of PCR duplicates (unique CLIP tags)
clustering of unique reads
Genome_build: Genome_build: mm10
Supplementary_files_format_and_content: bedgraph files generated from Ago-CLIP unique tags for genome browser
Submission date Dec 27, 2019
Last update date Dec 30, 2019
Contact name Sean O'Connor
Organization name Rockefeller University
Department Laboratory of Molecular Metabolism
Lab Paul Cohen
Street address 1230 York Ave
City New York
State/province NY
ZIP/Postal code 10065
Country USA
Platform ID GPL16417
Series (1)
GSE142677 AGO HITS-CLIP Reveals Distinct Patterns of miRNA Regulation of Visceral and Brown Adipose Tissue Identity
BioSample SAMN13691135
SRA SRX7450751

Supplementary file Size Download File type/resource
GSM4237683_Ago.CLIP_WAT_3t.tag.uniq.bedgraph.gz 1.2 Mb (ftp)(http) BEDGRAPH
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap