 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 30, 2020 |
| Title |
KO_2_GRO_seq |
| Sample type |
SRA |
| |
|
| Source name |
bone marrow-derived macrophages
|
| Organism |
Mus musculus |
| Characteristics |
agent: PBS
strain: C57BL/6
age: 8 weeks
genotype: MHD3KO
|
| Treatment protocol |
After 7 days of differeniation, BMDM were replated, rested overnight before treated with PBS control, LPS(5ng/ml for 4 hours)
|
| Growth protocol |
Control and MHD3KO mice were euthanized, and bone marrow were extracted for hindlimb femurs. Bone marrow cells were cultured for 7 days in DMEM supplemented with 10% FBS and 30% L929 media for 7 days on petri dishes to allow macrophage differentiation.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were washed twice with ice-cold PBS, then swelled in swelling buffer (10mM Tris pH 7.5, 2mM MgCl2, 3mM CaCl2) for 5 min on ice. Cells were centrifuged at 400g for 10 min, then resuspended in lysis buffer (swelling buffer with 10% glycerol and 1% Igepal) and incubated on ice for 5 min. Nuclei were washed twice with lysis buffer, then resuspended in freezing buffer (50mM Tris pH 8.3, 40% glycerol, 5mM MgCl2, 0.1mM EDTA). Nuclei were counted, pelleted, and 5 x 106 nuclei were resuspended in 100ul freezing buffer. For each library, run-on was performed on 4 tubes of 5 x 106 nuclei. For the run-on, cells were mixed with an equal volume of run-on buffer (10mM Tris pH 8.0, 5mM MgCl2, 1mM DTT, 300mM KCl, 20 units of SUPERase-In, 1% Sarkosyl, 500uM ATP, GTP and Br-UTP, 2uM CTP) and incubated for 5 min at 30°C. Nuclear RNA was extracted with TRIzol (Invitrogen) and precipitated with NaCl and ethanol overnight. The pellet was resuspended in water and the RNA was DNase treated (Ambion) for 30 min. RNA was hydrolyzed using fragmentation reagents (Ambion) for 13 min at 70°C and purified through a Micro Bio-Spin p-30 column (Bio-Rad) according to manufacturer's instructions. RNA was treated with 1.5ul T4 polynucleotide kinase (New England Biolabs) for 1h at 37°C, then with an additional 1l for 1h more. RNA was denatured for 5 min at 65°C. Anti-BrU agarose beads (Santa Cruz) were rotated for 1h in blocking buffer (0.5xSSPE, 1mM EDTA, 0.05% Tween-20, 0.1% PVP, and 1mg/ml BSA). Run-on RNA was rotated with beads for 1h, followed by washes twice in binding buffer (0.5xSSPE, 1mM EDTA, 0.05% Tween-20), twice in low salt buffer (0.2SSPE, 1mM EDTA, 0.05% Tween-20), once in high salt buffer (0.5x SSPE, 1mM EDTA, 0.05% Tween-20, 15mM NaCl), and twice in TET buffer (TE pH 7.4, 0.05% Tween-20). BrU-labeled RNA was eluted from the beads four times for 15 min with 10% elution buffer pre-heated to 42°C. RNA was ethanol-precipitated overnight.
Precipitated RNA was resuspended in water, denatured, and treated with poly(A)-polymerase (NEB) for 30 min at 37°C. cDNA synthesis was performed as described previously (Wang et al, Nature 2011) using oNTI223 primer ((5'-pGATCGTCGGACTGTAGAACTCT;CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3') where the p indicates 5' phosphorylation, indicates the abasic dSpacer furan and VN indicates degenerate nucleotides. The reaction was treated with 3 ul exonuclease I (Fermentas) for 15 min at 37°C, followed by 2 ul 1M NaOH for 20 min at 98°C, and neutralized with 1ul 2M HCl. cDNA was run on 10% TBE-urea gel, then products were excised and eluted from shredded gel pieces for 4h in TE + 0.1% Tween and precipitated in ethanol overnight. First-strand cDNA was circularized with CircLigase (Epicentre), denatured for 10 min at 80°C, and relinearized with APE I (NEB). Linearized DNA was amplified by PCR using Phusion Hot Start II Kit, according to manufacturer's instructions. The oligonucleotide primers oNTI200 (5'-CAAGCAGAAGACGGCATA-3') and oNTI201 (5'-AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGACG-3') were used for amplification. The PCR product was run on a 10% TBE gel and eluted as before. Libraries were sequenced on an Illumina hi-Seq2000 with sequencing primer 5'CGACAGGTTCAGAGTTCTACAGTCCGACGATC-3'.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Description |
Ctrl_all_transcripts_all_bidirectional_eRNAs.bed
|
| Data processing |
Library strategy: GRO-seq
adapter and poly-A sequence were trimmed off from the raw tags, then remaining tags were converted into FASTA format before alignment. Trimmed tags were aligned to the mouse genome, mm10, using Bowtie with the following options: inputs were in FASTA format (-f), three mismatches were allowed for each tags (-v 3), and only uniquely mapped tags were retained (-m 1).
All the alignments were adjusted to 50bp by extending toward 3'-end if their size is shorter than that to make libraries comparable. For stack-height profiles, all the replicates for each condition were pooled. genomeCoverageBed in bedtools was used first to make bedGraph files for plus and minus strands separately, where minus strand values were converted into negative ones.
Genome_build: mm10
Supplementary_files_format_and_content: bedGraph, bedgraph.tdf, and bed file of eRNA
|
| |
|
| Submission date |
Nov 18, 2019 |
| Last update date |
May 01, 2020 |
| Contact name |
Hoang Nguyen |
| E-mail(s) |
hoang.buinguyen@pennmedicine.upenn.edu
|
| Phone |
(215) 898-0198
|
| Organization name |
University of Pennsylvania Perelman School of Medicine
|
| Street address |
3400 Civic Center Boulevard
|
| City |
Philadelphia |
| State/province |
PA |
| ZIP/Postal code |
19104-5160 |
| Country |
USA |
| |
|
| Platform ID |
GPL21103 |
| Series (2) |
| GSE140573 |
Dichotomous Engagement of HDAC3 Activity Governs Inflammatory Responses [GRO-Seq] |
| GSE140611 |
Dichotomous Engagement of HDAC3 Activity Governs Inflammatory Responses |
|
| Relations |
| BioSample |
SAMN13320615 |
| SRA |
SRX7175991 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4174622_sorted_KO2_mm10.bedgraph.gz |
33.3 Mb |
(ftp)(http) |
BEDGRAPH |
| GSM4174622_sorted_KO2_mm10.bedgraph.tdf |
27.9 Mb |
(ftp)(http) |
TDF |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
