|
| Status |
Public on Nov 06, 2019 |
| Title |
DoxTam_rep1 |
| Sample type |
SRA |
| |
|
| Source name |
Mamary gland epithelial cell
|
| Organism |
Homo sapiens |
| Characteristics |
cell type: Breast adenocarcinoma
gender: Female
cell line: MCF-7
agent: doxycycline + tamoxifen
|
| Treatment protocol |
Cells were treated with doxycycline (50ng/ml) to induce PAX2 oeverexpresson, followed by tamoxifen (1uM) treatment for 6 hours.
|
| Growth protocol |
MCF-7 cells were cultured in DMEM with 10% FBS
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Nuclei were isolated after treatment, then they were used for nuclear run-on reaction (Br-UTP incorporation) followed by RNA isolation with TRIzol LS. Total RNA was used for library preparation.
5 ×10^6 nuclei were used for each run-on reaction, 2 biological replicates were produced for both vehicle and estrogen treatments. Br-UTP was incorporated into on-going transcription by run-on reaction which was performed at 30 degree for 5 min. Total RNA was extracted with TRIzol and fragmented with RNA Fragmentation Reagent. Fragmented RNA was purified with P-30 column, which was followed by T4 polynucleotide kinase treatment to dephosphorylate the 3’ end of RNA fragments. Br-UTP labeled RNA was enriched twice with anti-BrdU beads and precipitated overnight.PolyA tailing was done using E.coli Poly(A) Polymerase, followed by reverse transcription with oNTI-223-index: /5Phos/GATCGTCGGACTGTAGAACTCTGAAC/iSp18/TCAGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTTTTTTTTVN which allows custom barcoding. Exonuclease I was used to remove excess oligo after reverse transcription. DNA-RNA duplex was purified with ChIP DNA Clean & Concentrator Kit followed by RNAse H treatment. cDNA was circularized amplified with oNTI-201: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGACG and oNTI-200: CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT(XXXXXX is barcode used for specific sample) for 12 to 14 cycles. Final PCR product was purified by running 10% TBE gel and cleaned up.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
analyzeRepeat_PAX2_gene_expression_raw_counts.txt
analyzeRepeat_PAX2_gene_expression_fpkm.txt
analyzeRepeats_PAX2_intergenic_noadj_raw_counts.txt
analyzeRepeats_PAX2_intergenic_fpkm.txt
PAX2_DOX_TAM_1
|
| Data processing |
Library strategy: GRO-seq
Homer was used to trim polyA tail from 3' end, and only kept sequences longer than 25bp. Command: homerTools Trim -3 AAAAAAAAA -min 25
FastX Toolkit (0.013) was used to filter out low quality reads, (min. 97% of bases should have quality score of 10). Command: fastq_quality_filter -v -q 10 -p 97 -i input file -o output file
rRNA reads were filtered out with Bowtie 1.1.2. Command: bowtie rRNA_snRNA -q sample --un sample.rRNA_rm > sample.sam
Data was aligned to hg19 assembly with Bowtie 1.1.2. v=2, m=3, k=1.
Homer 4.6 was used to count reads in genes by using analyzeRepeats.pl, both non-adjusted reads and normalized FPKM values were calulated.
Differential expressed genes between treatments were called with DeSeq2 by using Homer command getDiffExpression.pl. -batch option was used to minimize the batch effect between different replicates.
getDistalPeaks.pl command from Homer was used to call intergenic transcripts. Only transcripts has minimu length of 300bp were kept, -intergenic, -noTTS options were used. All Refseq anotated genes (2015/08/31) were exluded.
Homer 4.6 was used to count reads in intergenic transcripts by using analyzeRepeats.pl, both non-adjusted reads and normalized FPKM values were calulated.
Differential expressed intergenic transcripts between treatments were called with DeSeq2 by using Homer command getDiffExpression.pl. -batch option was used to minimize the batch effect between different replicates.
Genome_build: hg19
Supplementary_files_format_and_content: Tab-delimited text files include non-normalized read counts and FPKM values for both genes and intergenic transcripts for each sample.
|
| |
|
| Submission date |
Nov 05, 2019 |
| Last update date |
Nov 07, 2019 |
| Contact name |
Shixiong Wang |
| E-mail(s) |
shixiong.wang@ncmm.uio.no
|
| Phone |
+47-22845865
|
| Organization name |
University of Oslo
|
| Department |
Centre for Molecular Medicine Norway
|
| Street address |
Gaustadalléen 21
|
| City |
Oslo |
| ZIP/Postal code |
0349 |
| Country |
Norway |
| |
|
| Platform ID |
GPL11154 |
| Series (1) |
| GSE139928 |
Genome wide analysis of transcripts regulated by PAX2 and Tamoxifen in MCF-7 cells |
|
| Relations |
| BioSample |
SAMN13197647 |
| SRA |
SRX7100381 |
