|
| Status |
Public on May 11, 2020 |
| Title |
PRO-seq_MJ-17-76_MED14-dTAG_2h_DMSO_C |
| Sample type |
SRA |
| |
|
| Source name |
PRO-seq_MJ-17-76_MED14-dTAG_2h_DMSO_C
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: KBM7
cell type: chronic myeloid leukemia cell line
genotype/variation: MED14-dTAG
treatment: 2h DMSO
experiment id: MJ-17-76
molecule subtype: nuclear RNA
|
| Treatment protocol |
60mio cells were treated for 0.5-2h with 500nM dTAG7, 500nM NVP2, or DMSO and 5% Drosophila S2 cells added for cross-normalization before extracting nuclei on ice.
|
| Growth protocol |
KBM7 cells were grown in IMDM medium supplemented with 10% FBS and 1% Pen/Strep.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
PRO-seq libraries were generated as previously described (PMID: 27442863), with 4 parallel run-on reactions per sample. Total RNA was merged after the first RNA precipitation step.
Library construction by PCR amplification with custom primers.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 3000 |
| |
|
| Description |
cross-compare only to MJ-17-76 samples
|
| Data processing |
library strategy: PROT-seq
conversion and demultiplexing: Illumina2bam
FASTQ conversion: bamtools v2.3.0 convert -format fastq
trimming: cutadapt v1.9.1 -a "TGGAATTCTCGGGTGCCAAGG" --minimum-length=10
reverse_complement: fastx_reverse_complement v0.0.14
alignment: 'bowtie v2.2.9 --very-sensitive' to a fused index of hg38_dm6_rDNA-U13369; later filtered with 'samtools v1.7 view -q 20'
spike-in_counting: number of reads aligning to dm6 were counted with "samtools view | awk '$3 ~ /dm6_/ {++dm6_count}'" and normalization factor alpha=1e6/dm6_count (see PMID: 25437568)
signal_trimming_to_3prime_base: only 3' base (Pol II active center) was retained in BED files with "bedtools v2.26.0 bamtobed | awk '($6 == "+") {print $1,$3-1,$3,$4,$5,$6}; ($6 == "-") {print $1,$2,$2+1,$4,$5,$6}'"
Genome_build: hg38
Supplementary_files_format_and_content: bigWig generation: spike-in normalized, strand-specific signal tracks were computed with 'bedtools v2.26.0 genomeCoverageBed -bg -strand -scale $alpha' followed by UCSC 'bedGraphToBigWig v4'
|
| |
|
| Submission date |
Oct 28, 2019 |
| Last update date |
May 12, 2020 |
| Contact name |
Georg E Winter |
| Organization name |
CeMM - Research Institute for Molecular Medicine of the Austrian Academy of Sciences
|
| Street address |
Lazarettgasse 14, AKH BT25.3
|
| City |
Wien |
| State/province |
Austria |
| ZIP/Postal code |
1090 |
| Country |
Austria |
| |
|
| Platform ID |
GPL21290 |
| Series (2) |
| GSE139462 |
Selective Mediator-dependence of cell type-specifying transcription [PRO-seq] |
| GSE139468 |
Selective Mediator dependence of cell-type-specifying transcription |
|
| Relations |
| BioSample |
SAMN13139740 |
| SRA |
SRX7064247 |
