 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Aug 26, 2022 |
| Title |
Bisulfite-seq_Donor 6.5TCR T cells which were converted to Tregs, rep3 |
| Sample type |
SRA |
| |
|
| Source name |
Lymphocytes
|
| Organism |
Mus musculus |
| Characteristics |
strain: Balb/c
cell type: T cell
sorting markers: CD45.1-CD45.2+CD3+CD4+CD25+Foxp3+
|
| Growth protocol |
Mice were housed at UKR central animal facility
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
T cell subsets were sorted directly into FACS buffer and then lysed with buffer ATL and proteinase K (Qiagen QIAamp DNA Micro Kit #56304) for one hour at 56°C. Buffer ATL and AL with carrier RNA were added and sample stored at -80°C until further processing. To isolate genomic DNA, samples were heated to 90°C for 30 minutes followed by column-based DNA isolation according to manufacturer’s protocol (Qiagen QIAamp DNA Micro Kit #56304). DNA was eluted in 40 µl buffer AE and sodium bisulfite conversion was performed (Qiagen EpiTect Plus DNA Bisulfite Kit #59124). Bisulfite-converted DNA was used to amplify regions of interest56 with the following PCR conditions: 4 µl bisulfite-converted DNA, 0.5 µl forward primer (10 µM), 0.5 µl reverse primer (10 µM), 5 µl 2X PCR buffer, 0.1 µl dNTPs and 0.1 µl hot-start Taq polymerase (PCR buffer, dNTPs and Taq from: ZymoTaq DNA Polymerase Kit #E2002). To detect Foxp3 methylation at the Treg-specific demethylated region, we used a forward primer TGGGTTTTTTTGGTATTTAAGAAAG and a reverse primer AAAAAACAAATAATCTACCCCACAA. To detect Il2ra gene methylation, we used a forward primer TTTTAGAGTTAGAAGATAGAAGGTATGGAA and a reverse primer TCCCAATACTTAACAAAACCACATAT. For Ikzf2 gene methylation, we used a forward primer AGGATGGTTTTTATTGAAGGTGAT and a reverse primer ATACACACCAAACAAACACTACACC. For Ctla4 gene methylation, we used a forward primer TGGTGTTGGTTAGTAGTTATGGTGT and a reverse primer AAATTCCACCTTACAAAAATACAATC. For Tnfrsf18 gene methylation, we used a forward primer GAGGTGTAGTTGTTAGTTGAGGATGT and a reverse primer AACCCCTACTCTCACCAAAAATATAA. PCR was initiated with 95°C for 10 minutes, followed by 40 cycles with denaturation (95°C-30sec), annealing (56°C-30sec) and elongation (72°C-30sec) completed with a final elongation step (72°C for 7 minutes). PCR products were combined, pre-purified with AMPure XP beads (Beckman Coulter #463881) and indexed for Illumina-based sequencing (NEBNext Ultra II DNA Library Prep Kit for Illumina #E7645S with NEBNext Multiplex Oligos for Illumina #E7335S). Samples were pooled in an equimolar ratio and supplemented with an unindexed PhiX spike-in (50% spike-in, Illumina FC-110-3001). Sequencing was performed on an Illumina MiSeq with a reagent nano kit v2 and 500 cycles of PCR.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Description |
BM Treg R3
|
| Data processing |
Library strategy: Targeted Bisulfite-seq
Indexed reads were aligned to the respective gene region and the mouse mm10 genome, followed by CG methylation calling and raw data table exporting using a customized code. For Foxp3, following CG dinucleotides were analyzed and plotted CG1 X:7,583,950; CG2 X:7,583,986; CG3 X:7,584,002; CG4 X:7,584,036; CG5 X:7,584,063; CG6 X:7,584,068. For Il2ra, following CG dinucleotides were analyzed and plotted CG1 2:11,645,653; CG2 2:11,645,705; CG3 2:11,645,718; CG4 2:11,645,738. For Ikzf2, following CG dinucleotides were analyzed and plotted CG1 1:69,670,284; CG2 1:69,670,291; CG3 1:69,670,370; CG4 1:69,670,377; CG5 1:69,670,385. For Tnfrsf18, following CG dinucleotides were analyzed: CG1 4:156,028,566; CG2 4:156,028,568; CG3 4:156,028,605; CG4 4:156,028,648; For Ctla4, following CG dinucleotides were analyzed: CG1 1:60,912,472; CG2 1:60,912,521; CG3 1:60,912,536; CG4 1:60,912,573; CG5 1:60,912,684.
Genome_build: mouse mm10
Supplementary_files_format_and_content: txt
|
| |
|
| Submission date |
Sep 04, 2019 |
| Last update date |
Aug 26, 2022 |
| Contact name |
Philipp Beckhove |
| E-mail(s) |
philipp.beckhove@rcii.de
|
| Organization name |
Regensburg Center for Interventional Immunology
|
| Street address |
Franz-Josef-Strauss-Allee 11
|
| City |
Regensburg |
| ZIP/Postal code |
93053 |
| Country |
Germany |
| |
|
| Platform ID |
GPL16417 |
| Series (2) |
| GSE136650 |
Induction of autoreactive regulatory T cells through promiscuous gene expression by bone marrow-resident Aire+ antigen-presenting cells |
| GSE136875 |
Assessment of the stabilty of Treg cell subsets in the bone marrow [targeted Bisulfite-seq] |
|
| Relations |
| BioSample |
SAMN12692338 |
| SRA |
SRX6801361 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4060093_Run2_Index4_panel_extracted.txt.gz |
732 b |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
