NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4052984 Query DataSets for GSM4052984
Status Public on Jan 06, 2020
Title Hi-C_WT 2.2
Sample type SRA
 
Source name HAP1
Organism Homo sapiens
Characteristics cell line: HAP1
genotype: Wild-Type
Treatment protocol gRNA targeting exon 1 of CTCF were designed and annealed into pX330 (primer: 5’- CGATTTTGAGGAAGAACAGC-3’). To modify the targeted locus we co-transfected a 120 basepair repair oligo containing the desired mutation and a silent mutation (repair oligo: 5’ – CCAAAAAGAGCAAACTGCGTTATACAGAGGAGGGCAAAGATGTAGATGTGTCTGTCGCCGATGCTGAAGAAGAACAGCAGGAGGGTCTGCTATCAGAGGTTAATGCAGAGAAAGTGGTTG-3’). pBabePuro was co-transfected in a 10:1 ratio to the pX330. Transfected clones were selected using 2 µg/µl puromycin for 2 days. gDNA of clones was isolated and send for Sanger sequencing to check for the desired mutation.
Growth protocol HAP1 cells (Carette et al., 2011) were cultured in IMDM (Invitrogen) supplemented with 10% FCS (Clontech), 1% Penicillin-Streptomycin (Invitrogen) and 0.5% Ultraglutamin (Lonza).
Extracted molecule genomic DNA
Extraction protocol Hi-C was performed essentially as previously described (Rao et al., 2014). Briefly, for each template roughly 10 million cells were crosslinked using 2% formaldehyde. In nucleus restriction was performed using MboI. Restriction overhangs were filled in with biotinylated nucleotides followed by blunt-end ligation. A streptavidin pull-down was performed to enrich for ligated sequences.
Pulled-down DNA was end-repaired and an A-overhang was added. Sequencing adapters were ligated to the DNA samples to create sequencing libraries.
 
Library strategy Hi-C
Library source genomic
Library selection other
Instrument model Illumina NovaSeq 6000
 
Description HiC_WT_merged_allValidPairs.gz
Data processing Raw sequence data was mapped and processed using HiC-Pro v2.9.0 (Servant et al., 2015).
After confirming high similarity between the different library preparations (1 and 2), the contact information was pooled together and processed to obtain merged contact matrices.
Genome_build: hg19
Supplementary_files_format_and_content: Hi-C summary files contain the genomic position and strand of the two pairs of a Hi-C ligation
 
Submission date Aug 29, 2019
Last update date Jan 06, 2020
Contact name Angela Sedeno Cacciatore
E-mail(s) a.sedeno.cacciatore@nki.nl, m.v.ruiten@nki.nl
Organization name Netherlands Cancer Institute
Department Gene regulation
Lab Rowland lab
Street address Plesmanlaan 121
City Amsterdam
State/province Noord-Holland
ZIP/Postal code 1066 CX
Country Netherlands
 
Platform ID GPL24676
Series (2)
GSE126636 The structural basis for cohesin/CTCF anchored loops [Hi-C]
GSE126637 The structural basis for cohesin/CTCF anchored loops
Relations
BioSample SAMN12657638
SRA SRX6770559

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap