|
| Status |
Public on Jan 06, 2020 |
| Title |
Hi-C_CTCF Y226A, F228A 2.1 |
| Sample type |
SRA |
| |
|
| Source name |
HAP1
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HAP1
genotype: CTCF Y226A, F228A
|
| Treatment protocol |
gRNA targeting exon 1 of CTCF were designed and annealed into pX330 (primer: 5’- CGATTTTGAGGAAGAACAGC-3’). To modify the targeted locus we co-transfected a 120 basepair repair oligo containing the desired mutation and a silent mutation (repair oligo: 5’ – CCAAAAAGAGCAAACTGCGTTATACAGAGGAGGGCAAAGATGTAGATGTGTCTGTCGCCGATGCTGAAGAAGAACAGCAGGAGGGTCTGCTATCAGAGGTTAATGCAGAGAAAGTGGTTG-3’). pBabePuro was co-transfected in a 10:1 ratio to the pX330. Transfected clones were selected using 2 µg/µl puromycin for 2 days. gDNA of clones was isolated and send for Sanger sequencing to check for the desired mutation.
|
| Growth protocol |
HAP1 cells (Carette et al., 2011) were cultured in IMDM (Invitrogen) supplemented with 10% FCS (Clontech), 1% Penicillin-Streptomycin (Invitrogen) and 0.5% Ultraglutamin (Lonza).
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Hi-C was performed essentially as previously described (Rao et al., 2014). Briefly, for each template roughly 10 million cells were crosslinked using 2% formaldehyde. In nucleus restriction was performed using MboI. Restriction overhangs were filled in with biotinylated nucleotides followed by blunt-end ligation. A streptavidin pull-down was performed to enrich for ligated sequences.
Pulled-down DNA was end-repaired and an A-overhang was added. Sequencing adapters were ligated to the DNA samples to create sequencing libraries.
|
| |
|
| Library strategy |
Hi-C |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
NextSeq 550 |
| |
|
| Description |
HiC_CTCF.Y226A.F228A_merged_allValidPairs.gz
|
| Data processing |
Raw sequence data was mapped and processed using HiC-Pro v2.9.0 (Servant et al., 2015).
After confirming high similarity between the different library preparations (1 and 2), the contact information was pooled together and processed to obtain merged contact matrices.
Genome_build: hg19
Supplementary_files_format_and_content: Hi-C summary files contain the genomic position and strand of the two pairs of a Hi-C ligation
|
| |
|
| Submission date |
Aug 29, 2019 |
| Last update date |
Jan 06, 2020 |
| Contact name |
Angela Sedeno Cacciatore |
| E-mail(s) |
a.sedeno.cacciatore@nki.nl, m.v.ruiten@nki.nl
|
| Organization name |
Netherlands Cancer Institute
|
| Department |
Gene regulation
|
| Lab |
Rowland lab
|
| Street address |
Plesmanlaan 121
|
| City |
Amsterdam |
| State/province |
Noord-Holland |
| ZIP/Postal code |
1066 CX |
| Country |
Netherlands |
| |
|
| Platform ID |
GPL21697 |
| Series (2) |
| GSE126636 |
The structural basis for cohesin/CTCF anchored loops [Hi-C] |
| GSE126637 |
The structural basis for cohesin/CTCF anchored loops |
|
| Relations |
| BioSample |
SAMN12657639 |
| SRA |
SRX6770558 |
