NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4052952 Query DataSets for GSM4052952
Status Public on Jan 06, 2020
Title CTCF ChIP - WT
Sample type SRA
 
Source name WT
Organism Homo sapiens
Characteristics cell line: HAP1
genotype: Wild-Type
replicate: 1
chip antibody: CTCF (Cell Signaling 3418S)
Treatment protocol gRNA targeting exon 1 of CTCF were designed and annealed into pX330 (primer: 5’- CGATTTTGAGGAAGAACAGC-3’). To modify the targeted locus we co-transfected a 120 basepair repair oligo containing the desired mutation and a silent mutation (repair oligo: 5’ – CCAAAAAGAGCAAACTGCGTTATACAGAGGAGGGCAAAGATGTAGATGTGTCTGTCGCCGATGCTGAAGAAGAACAGCAGGAGGGTCTGCTATCAGAGGTTAATGCAGAGAAAGTGGTTG-3’). pBabePuro was co-transfected in a 10:1 ratio to the pX330. Transfected clones were selected using 2 µg/µl puromycin for 2 days. gDNA of clones was isolated and send for Sanger sequencing to check for the desired mutation.
Growth protocol HAP1 cells (Carette et al., 2011) were cultured in IMDM (Invitrogen) supplemented with 10% FCS (Clontech), 1% Penicillin-Streptomycin (Invitrogen) and 0.5% Ultraglutamin (Lonza).
Extracted molecule genomic DNA
Extraction protocol Cells were fixed in 1% formaldehyde; 50mM Hepes-KOH; 100mM NaCl; 1 mM EDTA; 0,5 mM EGTA. Cell lysis was performed in LB1 buffer with final pH 7,5 (50 mM Hepes-KOH; 140mM NaCl; 1mM EDTA, 10% Glycerol, 0.5% NP-40; 0,25% Triton X-100; Proteinase inhibitor) for 20 minutes at 4°C. Subsequently, nuclei were lysed using LB2, pH 8,0 (10mM Tris-HCl; 200 mM NaCl; 1mM EDTA; 0,5mM EGTA; Proteinase inhibitor) for 10 minutes at 4°C. Pellets were resuspended in LB3 pH8,0 (10mM Tris-HCl; 100mM NaCl; 1 mM EDTA; 0,5 mM EGTA; 0.1% Na-Deoxycholate; 0.5% N-lauroylsarcosine; Proteinase inhibitor). Cross-linked chromatin was sheared (400-800 bp) using a Covaris S2 with Tube and Caps (Covaris, 520048), using the following settings: duty cycle: 10%, intensity: 4, cycles per burst: 200 time 40 seconds with 20 cycles. Chromatin precipitation was performed overnight using antibody-bound (CTCF 5 μl, SMC1 10 μl per IP) proteinA coupled DynaBeads (Invitrogen). Elution and decrosslinking was performed overnight at 65°C in EB pH 8,0 (50mM Tris-HCl; 10mM EDTA; 1% SDS). Samples were treated with Proteinase K and RNAseA for 2 hours. DNA was isolated using phenol extraction and ethanol precipitation.
Library preparation was done using a KAPA Library preparation kit using the manufacturer’s protocol.
 
Library strategy ChIP-Seq
Library source genomic
Library selection ChIP
Instrument model Illumina HiSeq 2500
 
Data processing Reads were trimmed using TrimGalore (Martin, 2011).
Reads were mapped to hg19 using Bowtie2.1.0 (Langmead and Salzberg, 2012) with default settings.
Peak calling was performed using MACS2 (Feng et al., 2012) with default options.
Genome_build: hg19
Supplementary_files_format_and_content: narrowPeak
 
Submission date Aug 29, 2019
Last update date Sep 10, 2020
Contact name Angela Sedeno Cacciatore
E-mail(s) a.sedeno.cacciatore@nki.nl, m.v.ruiten@nki.nl
Organization name Netherlands Cancer Institute
Department Gene regulation
Lab Rowland lab
Street address Plesmanlaan 121
City Amsterdam
State/province Noord-Holland
ZIP/Postal code 1066 CX
Country Netherlands
 
Platform ID GPL16791
Series (2)
GSE126634 The structural basis for cohesin/CTCF anchored loops [ChIP-seq]
GSE126637 The structural basis for cohesin/CTCF anchored loops
Relations
BioSample SAMN12657631
SRA SRX6777953

Supplementary file Size Download File type/resource
GSM4052952_CTCF_ChIPseq_WT_peaks.narrowPeak.gz 1.9 Mb (ftp)(http) NARROWPEAK
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap