 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jan 23, 2020 |
| Title |
004_neuronal_79_2242.1_hSS |
| Sample type |
SRA |
| |
|
| Source name |
forebrain spheroid
|
| Organism |
Homo sapiens |
| Characteristics |
purification: neuronal
differentiation media: hSS
individual: 2242-1
day of differentiation: 79
isolation method: facs
sample source: forebrain spheroid
cell count: 3600
assay batch: grp_20161208
|
| Treatment protocol |
Dissociation of neural spheroids and human tissue into single cells was performed as previously described (Birey et al., 2017; Paşca et al., 2015; Sloan et al., 2017; Zhang et al., 2016). Briefly, tissue was chopped and incubated in 40 U/ml papain enzyme solution at 37 °C for 90 minutes. The number of neural spheroids used per sample ranged from 3 to 15 depending on their age and size. After digestion, samples were washed with a protease inhibitor solution and gently triturated to achieve a single cell suspension. Single cell suspensions were then either FACS-sorted or immunopanned to achieve astrocyte- or neuron-enriched populations. For FACS-sorting, cells were resuspended in 0.2% BSA and DAPI-negative live cells were separated based on their expression of either GFP (pLV-GFAP-eGFP glia) or mCherry (AAV-DJ-hSYN1::mCherry neurons). Positive cells were sorted into ice-cold PBS. For immunopanning, the single cell suspension was added to a series of plastic petri dishes pre-coated with cell type-specific antibodies and incubated for 10-30 minutes at room temperature. Unbound cells were transferred to the subsequent petri dish, while the dish with bound cells was rinsed with PBS to wash away loosely bound contaminating cell types. An anti-Thy1 antibody (CD90, BD Biosciences, 550402) was used to harvest neurons, and an anti-HepaCAM antibody (R&D, MAB4108) was used to harvest astrocytes. Bound cells were then incubated in a trypsin solution (for glia) or Accutase (for neurons) at 37 °C for 3-5 minutes then gently pipetted off the plates with trypsin or Accutase. Cells were then spun down at 200 x g for 5 minutes, and resuspended in cold 0.2% BSA in PBS prior to RNA-seq and ATAC-seq.
|
| Growth protocol |
The generation and maintenance of hCS and hSS was performed as previously described (Birey et al., 2017; Paşca et al., 2015; Sloan et al., 2017). In brief, intact hiPS cell colonies were enzymatically lifted using dispase (0.35 mg/mL, Life Technologies, 17105) and transferred into ultralow-attachment plates in hiPS medium supplemented with the SMAD inhibitors dorsomorphin (5 μM, Sigma-Aldrich) and SB-431542 (10 μM, Tocris), and the ROCK inhibitor Y-27632 (10 μM, Selleckchem). The hiPS cell medium was changed and supplemented with dorsomorphin and SB-431542 every day. On the sixth day in suspension, the medium was switched to neural medium containing neurobasal A (Life Technologies, 10888), B-27 supplement without vitamin A (Life Technologies, 12587), GlutaMax (1:100, Life Technologies), penicillin and streptomycin (1:100, Life Technologies) and supplemented with EGF (20 ng/ml, R&D Systems) and FGF-2 (20 ng/ml, R&D Systems). The neural medium was changed every day until day 17 and then every other day until day 24. For the generation of hSS, the medium was additionally supplemented with the WNT pathway inhibitor IWP-2 (5 μM, Selleckchem) on days 4-24, the SHH pathway agonist SAG (100 nM, Selleckchem) on days 12-24, retinoic acid (RA, 100 nM, Sigma-Aldrich) on days 12-15 and allopregnanolone (100 nM, Cayman Chemicals, 16930) on days 15-24. From day 25 to day 43, the neural medium for both hCS and hSS was changed every other day and supplemented with BDNF (20 ng/ml, Peprotech) and NT3 (20 ng/ml, Peprotech). From day 45 onwards, hCS and hSS were maintained in neural medium without growth factors with medium changes every four to six days.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
ATAC-seq was performed as previously described (Buenrostro et al., Corces et al.) with modifications. Briefly, 10,000-50,000 cells were washed in ice-cold PBS, centrifuged at 4C for 5 min at 500 rcf, washed in ice-cold Resuspension Buffer (RSB, 10 mM Tris-HCl, 10 mM NaCl, 3 mM MgCl2, pH=7.4) and centrifuged again. Cells were resuspended in 50 uL Lysis Buffer (RSB plus 0.1 % NP-40 and 0.1% Tween-20) and centrifuged at 4C for 10 min at 500 rcf.
Pelleted nuclei were resuspended gently in 50 uL transposition mix (25 uL 2X Tagment DNA Buffer, 2.5 uL Tn5 Tagment DNA Enzyme 1, 0.1% Tween -20, H20) and incubated for 30 minutes at 37 C. DNA was cleaned using Qiagen MinElute columns, and PCR amplified 5 cycles in a 50 uL reaction with Illumina Nextera adaptors using NEBNext High Fidelity 2x Master Mix. A side qPCR reaction was performed using 10% of the pre-amplified PCR to determine the number of additional cycles to amplify. Final PCR products were cleaned using Qiagen MinElute columns and quantified by qPCR against a PhiX standard curve prior to pooling and sequencing to an average depth of ~10M filtered, deduplicated reads per sample on the Illumina NextSeq platform. Whole tissue samples were processed as previously described (Corces et al., 2017). Briefly, tissue samples were dounce homogenized and nuclei were isolated by gradient centrifugation prior to library preparation.
|
| |
|
| Library strategy |
ATAC-seq |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
NextSeq 550 |
| |
|
| Description |
nucleic acid
|
| Data processing |
Illumina base calling
SeqPurge trimming: SeqPurge -a1 CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -a2 CTGTCTCTTATACACATCTGACGCTGCCGACGA
bowtie2 alignment: bowtie2 -X 2000 --threads {threads} --rg-id {wildcards.sample_label} --fr --rg 'SM:{wildcards.sample_label}' -x [REFERENCE_FILE] -1 {input.left} -2 {input.right} | samtools view -hb -S - | samtools sort -o bams/unprocessed/{wildcards.sample_label}.bam -
macs2 peaks calling: macs2 callpeak -g 3e9 --treatment <sample BAM> --format BAMPE --nomodel --call-summits --nolambda --keep-dup all -p 0.01 -B –SPMR
bedtools overlap counts with multiBamCov
Genome_build: hg38
|
| |
|
| Submission date |
Jun 18, 2019 |
| Last update date |
Jan 23, 2020 |
| Contact name |
Nasa Sinnott-Armstrong |
| Organization name |
Stanford University
|
| Department |
Genetics
|
| Lab |
Pritchard Lab
|
| Street address |
318 Campus Drive, Clark Center S240
|
| City |
Stanford |
| State/province |
California |
| ZIP/Postal code |
94305 |
| Country |
USA |
| |
|
| Platform ID |
GPL21697 |
| Series (1) |
| GSE132403 |
Chromatin accessibility dynamics in a model of human forebrain development |
|
| Relations |
| BioSample |
SAMN12087505 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3896904_004_neuronal_79_2242.1_hSS.narrowPeak.gz |
6.5 Mb |
(ftp)(http) |
NARROWPEAK |
| Raw data not provided for this record |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
