NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM3896236 Query DataSets for GSM3896236
Status Public on Sep 24, 2019
Title m1A-IP-seq, "+AlkB", replicate3
Sample type SRA
 
Source name HEK-293T cells
Organism Homo sapiens
Characteristics cell line: HEK-293T cells
passages: p19
experimental: m1A-IP-seq, "+AlkB"
Extracted molecule total RNA
Extraction protocol RNA samples were extracted from HEK-293T cells using the TRIzol reagent and standard protocol; mRNA were enriched by the Dyna-Oligo(dT)25 beads and m1A IP was performed with the m1A antibody.
Libraries were constructed using ligation-based library construction approach incoporating the newly developed RT in the current work.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NovaSeq 6000
 
Description HZ77
Data processing PCR dupilcates were removed by the Raw data (R2 reads of the pair-end data) were first processed with the “clumpify.sh” program in the BBMap package (BBMap-Bushnell B.-sourceforge.net/projects/bbmap/) with the option “dedupe subs=0” to remove PCR duplicates.
Adaptors were trimmed by the “cutadapt” program while reads were filtered by quality and length with options “-a AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -q 20 -m 30”
Reads were aligned to the hg19 genome file downloaded from the UCSC database as well as the known splicing sites via the hisat2 aligner with the option “--trim5 11 ” removing the unique molecular identifier (UMI) sequence and not performing the soft-clipping at the end of reads, with the script “run_cut_alignment_R2_hg19.sh”.
Single base reads counting were performed with bam-readcount.
Genome_build: hg19
Supplementary_files_format_and_content: csv files containing mutation counts at base resolution
 
Submission date Jun 18, 2019
Last update date Sep 24, 2019
Contact name Huiqing Zhou
E-mail(s) zhouhq@uchicago.edu
Phone 7343899318
Organization name University of chicago
Street address LOADING DOCK BEHIND 5741 S DREXEL AVE 929 E 57TH ST
City Chicago
State/province Illinois
ZIP/Postal code 60637
Country USA
 
Platform ID GPL24676
Series (1)
GSE123365 Evolution of a Reverse Transcriptase to Map N1-Methyladenosine in Human mRNA
Relations
BioSample SAMN12086050
SRA SRX6087548

Supplementary file Size Download File type/resource
GSM3896236_HZ77R2.hg19soft.neg.readcount.mut_out.csv.gz 5.3 Mb (ftp)(http) CSV
GSM3896236_HZ77R2.hg19soft.pos.readcount.mut_out.csv.gz 5.6 Mb (ftp)(http) CSV
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap