 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 08, 2020 |
| Title |
QSC Rep 2 |
| Sample type |
SRA |
| |
|
| Source name |
Skeletal muscle
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL/6
cell type: Muscle stem cells
treatment: none
|
| Treatment protocol |
Cultured satellite cells were treated with siRNA targeting LncMyod for 48h before harvest.
|
| Growth protocol |
Satellite cells were isolated from mouse hindlimb and cultured in F10 supplemented with 10% HS and P/S.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Medium was removed and cells were lysed using ATAC-seq lysis buffer ( (10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% IGEPAL CA-630).
Library was constructed based on protocols from Buenrostro et al., (2015). Briefly, lysates were tagmented with Nextera DNA Library Preparation Kit (Illumina) and amplified using NEBNext High-Fidelity 2 x PCR Master Mix (NEB). Library was then sequenced using Illlumina NextSeq 500 (2 x 75).
|
| |
|
| Library strategy |
ATAC-seq |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
freshly isolated satellite cells
|
| Data processing |
Illumina bcl2fastq v2.19 with default parameters was used for basecalling to generate demultiplexed FASTQ files.
Adapters were trimmed using Trimmomatic v0.36 (Bolger et al., 2014) with parameters ‘ILLUMINACLIP:NexteraPE-Custom.fa:1:13:6:1:True SLIDINGWINDOW:10:10 MINLEN:15’. For the ILLUMINACLIP setting, a custom Nextera paired end adapter FASTA file was used containing the following four adapter entries in it: PrefixA/1 – CTGTCTCTTATACACATCTCCGAGCCCACGAGAC, PrefixA/2 – CTGTCTCTTATACACATCTGACGCTGCCGACGA, Trans1 – TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, Trans2 – GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG.
Trimmed reads were mapped to mm10 using bowtie2 v2.3.2 (Langmead et al., 2009) with parameters ‘--minins 30 --maxins 2000 --dovetail -k 4 --very-sensitive-local’
Duplicates reads were marked using the MarkDuplicates module of Picard v2.9.2 with default settings.
Next, unmapped reads, duplicate reads, non-primary alignments, reads with their mate unmapped and read alignments with a mapping quality below 30 were removed using samtools v1.3 (Li et al., 2009) with parameters ‘-F 1804 -f 2 -q 30 -b’.
Broad peak calling to determine enriched ATAC regions was performed on individual sample replicates as well as pooled replicates using MACS2 v2.1.1 (Zhang et al., 2008) with parameters ‘--nomodel --shift -100 --extsize 200 –broad’. Peaks in blacklisted regions (ENCODE Project Consortium, 2012) were filtered using the bedtools v2.26.0 (Quinlan, Hall, 2010) intersect command.
To generate Tn5 insertion signal tracks, the BAM file created after the read filtering step for each sample replicate was downsampled to the BAM file with the smallest read count using the DownsampleSam module of Picard v2.9.2. Genome wide insertion count tracks were then generated for individual replicates and pooled replicates using the pyatac ins functionality in NucleoATAC v0.3.4 (Schep et al., 2015).
Genome_build: mm10
Supplementary_files_format_and_content: broadPeak files with blacklisted peaks removed; BigWig files of Tn5 insertion counts along mm10 after downsampling step
|
| |
|
| Submission date |
Apr 12, 2019 |
| Last update date |
Dec 08, 2020 |
| Contact name |
Tom Cheung |
| Organization name |
Hong Kong University of Science and Technology
|
| Department |
Division of Life Science
|
| Street address |
Clear Water Bay, Kowloon
|
| City |
Hong Kong |
| ZIP/Postal code |
N/A |
| Country |
Hong Kong |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE129745 |
Chromatin structure profiling of mouse muscle stem cells by ATAC-seq |
| GSE129768 |
A Long Noncoding RNA, LncMyod, Regulates Myogenic Lineage Progression by Modulating Chromatin Accessibility |
|
| Relations |
| BioSample |
SAMN11406795 |
| SRA |
SRX5676447 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3721318_qsc2.ins.bw |
310.7 Mb |
(ftp)(http) |
BW |
| GSM3721318_qsc2_peaks_filtered.broadPeak.gz |
1.6 Mb |
(ftp)(http) |
BROADPEAK |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
