 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 05, 2019 |
| Title |
4C-rDNA-old primers hs+ rep1 |
| Sample type |
SRA |
| |
|
| Source name |
HEK293T
|
| Organism |
Homo sapiens |
| Characteristics |
strain: HEK293T
tissue: kidney
genotype: wild type
stress: heatshock
|
| Treatment protocol |
Heat shock treatment was performed for 30 min at +43°C followed by recovery for 2.5 h at +37°C.
|
| Growth protocol |
HEK293T cells were grown in DMEM with 10% FBS in a humidified incubator at 37°C and 5% CO2 to 80% confluency.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
DNA samples were prepared as described before (Dekker et al., 2002; Osborne et al., 2004; http://www.protocol-online.org/cgi-bin/prot/view_cache.cgi?ID=3978). Cross-linking To suspension containing about 20x106 HEK293T cells in 40 ml of DMEM formaldehyde solution was added to final concentration 1.5%. After mixing incubation of cell suspension was performed for 10 min at room temperature with mixing. The quenching with 2.75 ml of 2M glycin (final concentration 0.125M) was performed. After incubation at room temperature for 5 min the suspension was cooled for 15 min in ice bath and then cells were collected by centrifugation for 15 min at 3500 rpm at +2°C. Lysis The pellet of cells was resuspended at °C in 1ml of buffer containing 10 mM tris-HCl buffer, pH 8, 10 mM NaCl, 0.2% NP-40 and freshly added protease inhibitors – 0.1 mM PMSF and 1:500 protease inhibitor cocktail (Sigma). After incubation for 15 min cells were homogenized by passing through insulin syringe about 50 times into Eppendorf. Then nuclei were spin down by centrifugation for 5 min at 5000 rpm in Eppendorf centrifuge 5415 R at +2°C. Digestion with EcoRI The nuclei pellet was resuspended in 756 l of solution containing 40 mM tris-HCl buffer, pH 7.4, 50 mM NaCl, 10 mM MgCl2 and 10 mM 2-mercaptoethanol. Then 20% SDS was added to final concentration 0.3% and incubation with shaking was performed for 1 h at +37°C. To sequester SDS 180 l of 10% Triton X-100 was added and the incubation for 1 h at +37°C was performed. Before digestion 1 l of BSA (5 mg/ml) was added with mixing. Then 50 l of EcoRI (10 u/l) was added and after mixing digestion was performed overnight at +37°C. Ligation To inactivate the restriction enzyme, 35l of 20% SDS was added (final concentration 0.7%) and the probe was heated to 65°C for 30 min. Then the mixture was transferred into 15 ml Nunc tube and consequently 375 l of 20% Triton X-100 (to final concentration 1%), 750 l of 10x ligase buffer, 7,5l of BSA (5 mg/ml), 80l of 100 mM ATP, and 5241l of milliQ water were added and the final 7.5 ml solution was well mixed. Then 10 l of T4 DNA ligase (200 u/l) was added and after mixing incubation was performed for 5 h at +16°C and then for 30 min at room temperature. Usually during ligation DNA concentration was equal to 2 ng/l. DNA purification For isolation of DNA 50l of proteinase K (10 mg/ml) was added (final concentration 50 g/ml) and after mixing incubation was performed at 55°C B1overnight. For RNA digestion 40l of RNase A (10 mg/ml) was added (final concentration 0.5 g/ml) and after mixing incubation was performed for 30 min at +37°C. After extensive extraction with phenol-chloroform extraction (three times with 7 ml each) DNA was precipitated by 2.5 vol. of ethanol after addition of 40 l 10 mg/ml glycogen and 175 l 4M NaCl. The final DNA pellet was washed twice with 70% ethanol and then dissolved in 0.1xTE. Digestion with FaeI About 15 g of DNA was digested in 250l solution with 75 u of FaeI overnight at +37°C. Then the enzyme was inactivated by heating at 65°C for 30 min. DNA was isolated after phenol-chloroform extraction, precipitated by ethanol and dissolved in 100l of 0.1xTE. Ligation For circularization 15g of DNA was incubated in 8 ml of T4 DNA ligase buffer containing 400 u of T4 DNA ligase for 5 h at +16°C. DNA was isolated after phenol-chloroform extraction, precipitated by ethanol and dissolved in 50l of 0.1xTE. PCR and library preparation One or two rounds of PCR were used as described below. There are about 300-400 copies of rDNA. That is why a single round of PCR (with up to 35 cycles) was found to be sufficient. DNA concentration was titrated and finally about 30 ng of DNA was used for PCR with primers 5’ TCTTTGAAAAAAATCCCAGAAGTGGT 3’ and 5’ AAGTCCAGAAATCAACTCGCCAGT 3’ (for PCR-1), and 5’ GCCTAAGCCTGCTGAGAACTTTC 3’ and 5’ CAGCATTCTGTAGGGAGATCAAATC 3’ (for PCR-2). After separation in 2% agarose gels two DNA fractions (200-400 bp and higher 400 bp) were eluted using QIAqiuck gel extraction kit (Quigen). The libraries were prepared using TruSeq RNA Sample Preparation Kit v2 (Illumina) using adapter AR006 for 200-400 bp DNA fraction and adapter R007 for DNA fraction higher 400 bp. The samples were sequenced using MiSeq (Illumina).
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 1500 |
| |
|
| Description |
Replica 1
|
| Data processing |
Base calling and quality control were performed in real time with standard Illumina analysis pipeline using a phiX control.
Sequenced reads were trimmed for adaptor sequences and low quality sequences by cutadapt v. 1.16 using the following options: --trim-n --times=6 --minimum-length 20 -q 26 --untrimmed-output=4C_notail.fastq.gz -g CTAAGCCTGCTGAGAACTTTC -g GCATTCTGTAGGGAGATCAAATC -a GAAAGTTCTCAGCAGGCTTAG -a GATTTGATCTCCCTACAGAATGC -a GATCTCCCTACAGAATGCTG
Untrimmed sequences from the file 4C_notail.fastq.gz were trimmed for the following adaptor sequences by cutatapt v. 1.16 using the following options --trim-n --times=6 --trimmed-only --minimum-length 20 -q 26 -g GAAAAAAATCCCAGAAGTGGT -g TCCAGAAATCAACTCGCCAGT -a ACTGGCGAGTTGATTTCTG -a ACCACTTCTGGGATTTTTTTC. Then outputs of previous and current adaptor removal steps were concatenated in one file 4C_trimmed.fastq.gz for furher processing
Trimmed reads were mapped to hg19p13 by bwa 0.7.12-r1039 using the mem algorithm. All non-aligned reads were removed from resulting alignment file by samtools 1.6: -b -S -F 4 -@ 10 allalign.sam > aligned.bam
Mapping and alignment results were converted to resulting tables using samtools 1.6 and ad hoc Perl scripts.
Each replica results table was converted to bedGraph file for further processing using reads amount as data value. Intersection file was built by bedtools v. 2.27.1 with the following command line: bedtools intersect -a 4C_hg19_old_hs+_rep1.bedGraph -b 4C_hg19_old_hs+_rep2.bedGraph -wb. Ad hoc Perl script was used to convert bedtools output file back to bedGraph file with summing up in the overlapped regions.
Genome_build: Homo Sapiens hg19/GRCh37.p13 genome with included to chr14 from address 1 Human ribosomal DNA U13369
Supplementary_files_format_and_content: Tab-delimited text file include the following features of each mapping: begin, end, length, coverage, number of reads, sequence. bedGraph files for each replica and intersection are supplied too.
|
| |
|
| Submission date |
Oct 17, 2018 |
| Last update date |
Dec 05, 2019 |
| Contact name |
Nickolai Tchurikov |
| E-mail(s) |
tchurikov@eimb.ru
|
| Organization name |
Engelhardt Institute of Molecular Biology
|
| Department |
Department of Epigenetic Mechanisms of Gene Expression Regulation
|
| Street address |
32, Vavilova str.
|
| City |
Moscow |
| ZIP/Postal code |
119991 |
| Country |
Russia |
| |
|
| Platform ID |
GPL18460 |
| Series (2) |
| GSE121417 |
Genome-wide contacts of rDNA units detected by 4C procedure in human genome [old.hs] |
| GSE121418 |
Genome-wide contacts of rDNA units detected by 4C procedure in human genome |
|
| Relations |
| BioSample |
SAMN10253911 |
| SRA |
SRX4900876 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3435445_4C_hg19_old_hs+_rep1.bedGraph.gz |
559.7 Kb |
(ftp)(http) |
BEDGRAPH |
| GSM3435445_4C_hg19_old_hs+_rep1.txt.gz |
2.9 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
