NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM3423601 Query DataSets for GSM3423601
Status Public on Jul 08, 2019
Title OE_Zscan4
Sample type SRA
 
Source name Embryonic stem cell
Organism Mus musculus
Characteristics strain: 12910la
cell line: J1
genotype: Zscan4 overexpression
Treatment protocol The CDS region of Zscan4c was cloned into pCMV-FLAG vector.WT mESCs were transfected with 1000ng pCMV-tag2 vector.After transfection for 24h,the cells were treated with 500ug/ml G418 for 10days and the medium were changed every 24h, then we picked monoclonal cells.
Growth protocol Mouse J1 embryonic stem cells (ESCs) were cultured under 5% CO2 at 37℃ on well plate coated with 0.2% gelatin(Sigma),in medium(Hyclone) that supplement with15% FBS(Hyclone),10ng/ml mLIF (GeneScript),1% Penicillin-Streptomycin (Solarbio),1% GlutaMAX(Solarbio), 1% nonessential amino acids(Gibco), 0.1 mM β-mercaptoethanol (Sigma). .
Extracted molecule genomic DNA
Extraction protocol Cells were lysed and chromatin was extracted. Anti-FLAG antibody was used to immunoprecipiate FLAG-Zscan4 in mESCs. Proteins on chromatin associated with Zscan4 was digested and chromatin was decrosslinked at 65 degree overnight. DNA was extracted in phenol-chloroform.
For ChIP-seq, 5ng of Zscan4-assocated chromatin DNA was used in ChIP-seq library preparation. Libraries were prepared according to Illumina protocols and library fragments of ~250 bp were used for sequencing.
 
Library strategy ChIP-Seq
Library source genomic
Library selection ChIP
Instrument model HiSeq X Ten
 
Data processing Illumina RTA software used for image identification and basecalling.
Adaptor sequence and low-quality sequence were trimmed by Cutadapt with parameters " -q 5 -m 30 -n 4 -O 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", then sequence reads were mapped to mm10 genome using Bowtie2 with parameters "-5 1 --very-sensitive -p 20 -I 0 -X 1000 --no-mixed --no-discordant --un-conc-gz".
Zscan4 peak bed file was called by macs2 with parameters "-f BAMPE -g mm -q 0.1 --keep-dup auto".
Zscan4 enrichment bigwig file was generated by bamCompare from Deeptools with parameter "--scaleFactorsMethod readCount -e --minMappingQuality 1 --samFlagExclude 256 --pseudocount -1 --operation ratio"
Genome_build: mm10
Supplementary_files_format_and_content: bed file of Zscan4 peaks and bigwig file of Zscan4 enrichment.
 
Submission date Oct 09, 2018
Last update date Mar 29, 2020
Contact name Weiyu Zhang
E-mail(s) ch8316f5eyu@gmail.com
Phone 18902012072
Organization name Nankai University
Street address No.38 Tongyan Road, Jinnan District
City Tainjin
ZIP/Postal code 300350
Country China
 
Platform ID GPL21273
Series (1)
GSE125238 CHIP-seq analysis about Histones and Zscan4 after Zscan4 overexpression
Relations
BioSample SAMN10221861
SRA SRX7992673
SRA SRX4817756

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap