|
| Status |
Public on Sep 04, 2018 |
| Title |
pcr_wafergen_expt_standard |
| Sample type |
SRA |
| |
|
| Source name |
Human Breast Cancer Xenograft
|
| Organism |
Homo sapiens |
| Characteristics |
sample type: Human Breast Cancer Xenograft
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Wafergen Illumina libraries at 2 nM concentration were diluted 20 fold and PCR amplified with 1 unit of Phusion and the cell specific primer and Nextera read 2 sequencing primer to specifically amplify the sequences from the selected cells for 14 cycles. PCR results were confirmed by gel electrophoresis and the remaining sample was purified with Ampure XP beads at a ratio of 1.8x bead/pcr volume. Samples were eluted and added in equal volume to prepared Dynabead M270 streptavidin beads. Beads were incubated for 15 minutes at room temperature with gentle rotation. Beads were washed 5x in bind and wash buffer and eluted in 20µl of water. 10µl of streptavidin purified input DNA was added to PCR using PEPCRPrimer 1.0 (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and Nextera N703 (CAAGCAGAAGACGGCATACGAGATttctgcctGTCTCGTGGGCTCGG) for 9 cycles. PCR products were ampure purified, confirmed on the Agilent Tapestation D1000, quantified by the Qubit and submitted for sequencing. Read 1 positions 1-11 contain the 11bp cell barcode, and positions 12-22 contain a 10bp UMI. Read 2 contains the cDNA.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina MiSeq |
| |
|
| Description |
Resampled single cell RNA seq library from the Wafergen iCell 8 platform. Human Breast Cancer xenograft into mice, cells isolated from a primary fatpad tumor, a brain metastasis, a bone metastasis, or the original primary cell line. Cell barcode targeted PCR was used to reamplify selected cells for targeted resequencing. Standard PCR primers were used.
pcr_wafergen_expt_bcs.txt
|
| Data processing |
Data analysis pipeline and custom scripts are provided in a github repository (https://github.com/rnabioco/scrna-subsets). Single cell RNA-Seq libraries were preprocessed to append the read 1 sequence to the paired read 2 read id (append_read_name) followed by quality trimming and poly(A) tail removal from read 2 using cutadapt (v. 1.8.3 -a 'A{{100}}' -O 6 -m 20 -q 10) (Martin 2011). Reads were next aligned with STAR (Dobin et al. 2013) to either the human genome assembly (hg38) for the PBMC experiments or a genome with both human (hg38) and mouse (mm38) sequences for all other experiments. Sequence headers in the human/mouse combined genome were prefixed with either an “H_” or “M_” to designate human or mouse references respectively. Following alignment, BAM files were processed to extract the cell barcode and UMI sequences into tags (CN and BX) within the BAM file (barcode_tag_bam). The cell barcode was error corrected against a list of cell barcodes, either as known well barcodes (Wafergen experiments), or generated from the original 10x genomics single cell libraries processed with the 10x genomics software cellranger (v. 2.1.1). Cell barcodes within edit distance of 1 of the known barcodes were considered valid cell barcodes and corrected to the known barcode. Alignments not designated as multi-mapping that overlapped distinct exonic features were tagged in the BAM file (subread v. 1.6.0) (Liao et al. 2014). Gencode v25 annotations was used for human data, and a union reference containing Gencode v25 and mouse v11 was used for human/mouse datasets. UMIs per gene were enumerated per cell using umi-tools (v 0.5.3) (Smith et al. 2017) using the directional method to disambiguate similar UMI sequences.
Genome_build: mm38, hg38
Supplementary_files_format_and_content: Text files containing cell barcode sequences, count matrices of UMIs per gene per cell are provided. For the TCR single cell libraries JSON files are provided with detailed annotations for each assembled contig per cell.
|
| |
|
| Submission date |
Sep 04, 2018 |
| Last update date |
Sep 05, 2018 |
| Contact name |
Kent Augustus Riemondy |
| Organization name |
University of Colorado School of Medicine
|
| Department |
Biochemistry and Molecular Genetics
|
| Street address |
12801 E 17th Ave
|
| City |
Aurora |
| State/province |
Colorado |
| ZIP/Postal code |
80045 |
| Country |
USA |
| |
|
| Platform ID |
GPL15520 |
| Series (1) |
| GSE119428 |
Recovery and analysis of transcriptome subsets from pooled single-cell RNA-seq libraries |
|
| Relations |
| BioSample |
SAMN09951394 |
| SRA |
SRX4637898 |
