NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM3305298 Query DataSets for GSM3305298
Status Public on Jul 26, 2018
Title wild type-4
Sample type SRA
 
Source name B cells
Organism Mus musculus
Characteristics cell type: anti-CD40 and Il4 activated B cells
genotype: wild type
strain: 129
Treatment protocol Cells were cultured for 4 days and analyzed via flow cytometry before DNA extraction.
Growth protocol Purified splenic B (CD43-) cells from mice carrying preassembled IgH and IgK loci (129Sv background) were cultured in RPMI mediume with cytokines (anti-CD40 (1 ng/mL; BD Pharmingen) and IL-4 (20 ng/mL; R&D)). Due to low splenic B cell number, DNA-PKcs KD/KDTp53-/- splenic cells were used for stimulation without purification.
Extracted molecule genomic DNA
Extraction protocol Genomic DNA was extracted from day 4 cultured B cells.
Libraries were prepared according to protocol in (Hu J, et al. Nat Protoc 11:853–871.(2016)) Linear amplifications were performed using Sμ-specific biotin primer 5′/5BiosG/CAGACCTGGGAATGTATGGT3′) and followed by nesting PCR with (5′CACACAAAGACTCTGGACCTC3′) AflII is used to remove germ-line sequence.
high-throughput genome translocation sequencing (HTGTS). Sequenced with MiSeq 500v
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model Illumina MiSeq
 
Description wild_type_pool_results.xlsx
Data processing Library strategy: HTGTS
Basecalls performed using Illumina RTA version 1.18.54
Miseq reads was first de-multiplexed by fastq-multx tool from ea-util, then adaptor sequence was further trimmed with SeqPrep utility.
Pre-processed reads were then mapped to customized mm9 genome (mm9sr) with IgH switch region (from JH4 to the last Cα exon, chr12 114, 494, 415–114, 666, 816) of the C57/BL6 replaced by the corresponding region of 129 strain in NCBI gene accession sequence AJ851868.3 using Bowtie2. The best-path searching algorithm (related to YAHA; ref. 50) was used to identify optimal sequence alignments from Bowtie2-reported top alignments (alignment score > 50).
The reads are then filtered to exclude mispriming events, germ-line (unmodified) sequence, sequential joints, and duplicated reads. A “duplicate read” is defined by bait and prey alignment coordinates within 2 nt of another read’s bait and prey alignments. To plot all of the S-region junctions, including those in the repeats but unequivocally mapped to an individual switch region, we combined the ones filtered by a mappability filter but unequivocally mapped to S regions with “good” reads passing both the mappability (both deduplicated) filters (please see ref. 28 for simulation and details on plotting). MHs are defined as regions of 100% homology between the bait and prey-break site. Insertions are defined as regions containing nucleotides that map to neither the bait and prey-break site. Blunt junctions are considered to have no MHs or insertions.
Mutation rate was calculated by custom Excel integrated VBA script. Mutations were determined by comparing the actual bait sequence of each IgH junction with the germ-line bait sequence based on the IgH sequence from 129/Sv strain (NCBI gene accession no. AJ851868.3). Only true mismatches (no insertion or deletion within 7 nt) were counted as a mutation.
Genome_build: mm9sr (to customized mm9 genome (mm9sr) with IgH switch region (from JH4 to the last Cα exon, chr12 114, 494, 415–114, 666, 816) of the C57/BL6 replaced by the corresponding region of 129 strain in NCBI gene accession sequence AJ851868.3)
Supplementary_files_format_and_content: .xlsx files generated from tab-delimited text files after analysis for reads distribution and mutation rates.
 
Submission date Jul 25, 2018
Last update date Jul 26, 2018
Contact name Zhengping Shao
E-mail(s) zs2275@cumc.columbia.edu
Phone 212-851-4785
Organization name Columbia University Medical Center
Department ICG
Lab Shan Zha Lab
Street address 1130 St. Nicholas Ave
City New Yprk
State/province New York
ZIP/Postal code 10033
Country USA
 
Platform ID GPL16417
Series (1)
GSE117628 Kinase-dependent structural role of DNA-PKcs during immunoglobulin class switch recombination
Relations
BioSample SAMN09711860
SRA SRX4455220

Supplementary file Size Download File type/resource
GSM3305298_wild_type_4_results.xlsx.gz 376.3 Kb (ftp)(http) XLSX
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap