 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Feb 06, 2020 |
| Title |
GS RA120h H3K27Ac |
| Sample type |
SRA |
| |
|
| Source name |
GS RA120h
|
| Organism |
Mus musculus |
| Characteristics |
cell type: Germline stem (GS) cell line
Sex: male
treatment: 100 nM retinoic acid for 120 hours
antibody: anti-H3K27Ac (Active motif 39133)
|
| Treatment protocol |
100 nM retinoic acid (Sigma) was added to the culture media for times indicated in the file names. In order to suppress apoptosis in response to retinoic acid, BAX shRNA lentivirus vectors (GAGATGAACTGGACAGCAATA, TCAAGGCCCTGTGCACTAAAG) were transduced to GS cells or 50 uM Z-VAD-FMK was added to the culture media.
|
| Growth protocol |
Germline stem (GS) cells (kindly provided by Dr Takashi Shinohara) were cultured on mitomycin C treated primary embryonic fibroblast (PEF) cells according to the previous report (Kanatsu-Shinohara et al., Biol Reprod., 2003, 69, 612-616) with minor modifications. Before GS cell sampling, PEF cells were removed by a differential attachment method to gelatin coated dishes following standard procedures
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
For RAR ChIP, cells were fixed in 2 mM disuccinimidyl glutarate, 1.5 mM ethylene glycolbis succinimidyl succinate in PBS followed by 1% formaldehyde. Crosslinked cells were lysed in 1% SDS, 10 mM EDTA, 50 mM Tris with protease inhibitors by sonication with Covaris S220. ChIP was performed by using anti-pan RAR antibody (Santa Cruz sc-773) and protein A/G agarose beads. For H3K4me3 and H3K27me3 ChIP, cells were fixed in 0.5% formaldehyde in PBS. Crosslinked cells were first lysed in 0.3M sucrose, 60 mM KCl, 15 mM NaCl, 5 mM MgCl2, 0.1 mM EDTA, 15 mM Tris, 0.5 mM DTT, 0.5% TritonX-100 with protease inhibitors, then nuclei were pelleted by centrifugation of the above lysates on 1.2 M sucrose, 60 mM KCl, 15 mM NaCl, 5 mM MgCl2, 0.1 mM EDTA, 15 mM Tris, 0.5 mM DTT. Nucleosome fractions were obtained by MNase treatment. ChIP was performed by using anti-H3K4me3 (Abcam ab8580) or anti-H3K27me3 (Upstate 07-449) and protein A/G agarose beads. For H3K27Ac ChIP, cells were fixed 1% formaldehyde in PBS. Crosslinked cells were lysed in 1% SDS, 10 mM EDTA, 50 mM Tris with protease inhibitors by sonication with Covaris S220. ChIP was performed by using anti-H3K27Ac (Active motif 39133) and protein A/G agarose beads. Eluates were treated with RNase A and Proteinase K followed by phenol/chloroform extraction and ethanol precipitation of DNA.
For RAR, H3K4me3 and H3K27me3 ChIP, libraries were constructed from one (RAR) or five (H3K4me3 and H3K27me3) nanogram of ChIP DNA and five nanogram of input DNA using Illumina ChIP-seq sample prep kit (Illumina) and sequenced by GAIIX with Illumina Sequencing kit v4. For H3K27Ac ChIP-seq, libraries were constructed from one nanogram of ChIP DNA using TruSeq ChIP Sample Preparation Kit (Illumina) and sequenced by MiSeq with MiSeq Reagent Kit v2 (Illumina).
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina MiSeq |
| |
|
| Data processing |
ChIPseq reads were aligned to the mouse genome (mm10) using Bowtie2 2.3.4.1.
Macs2 2.1.0 callpeak and bdgcomp were used to process aligned ChIPseq reads.
Genome_build: mm10
Supplementary_files_format_and_content: Bdg files were generated by Macs2 2.1.0. Data represent fragment pileup per million reads subtracted by control lambda values.
|
| |
|
| Submission date |
Jul 09, 2018 |
| Last update date |
Feb 07, 2020 |
| Contact name |
Shinichiro Chuma |
| E-mail(s) |
chuma.shinichiro.3x@kyoto-u.ac.jp
|
| Phone |
+81-75-751-3821
|
| Organization name |
Kyoto university
|
| Department |
Institute for Frontier Life and Medical Sciences
|
| Lab |
Laboratory of Developmental Epigenome
|
| Street address |
53 Kawahara-cho, Shogoin, Sakyo-ku
|
| City |
Kyoto |
| State/province |
Kyoto |
| ZIP/Postal code |
606-8507 |
| Country |
Japan |
| |
|
| Platform ID |
GPL16417 |
| Series (2) |
| GSE116784 |
Transcriptomic and epigenetic profiling of genome control in the germline stem cell cycle in mice [ChIP-seq] |
| GSE116798 |
Transcriptomic and epigenetic profiling of genome control in the germline stem cell cycle in mice |
|
| Relations |
| BioSample |
SAMN09632135 |
| SRA |
SRX4369787 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3261906_GS_RA120h_H3K27A_subtract.bedGraph.gz |
109.1 Mb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
