NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM3261898 Query DataSets for GSM3261898
Status Public on Feb 06, 2020
Title GS control WCE RAR
Sample type SRA
 
Source name GS control
Organism Mus musculus
Characteristics cell type: Germline stem (GS) cell line
Sex: male
treatment: Control
antibody: anti-pan RAR antibody (Santa Cruz sc-773)
Treatment protocol 100 nM retinoic acid (Sigma) was added to the culture media for times indicated in the file names. In order to suppress apoptosis in response to retinoic acid, BAX shRNA lentivirus vectors (GAGATGAACTGGACAGCAATA, TCAAGGCCCTGTGCACTAAAG) were transduced to GS cells or 50 uM Z-VAD-FMK was added to the culture media.
Growth protocol Germline stem (GS) cells (kindly provided by Dr Takashi Shinohara) were cultured on mitomycin C treated primary embryonic fibroblast (PEF) cells according to the previous report (Kanatsu-Shinohara et al., Biol Reprod., 2003, 69, 612-616) with minor modifications. Before GS cell sampling, PEF cells were removed by a differential attachment method to gelatin coated dishes following standard procedures
Extracted molecule genomic DNA
Extraction protocol For RAR ChIP, cells were fixed in 2 mM disuccinimidyl glutarate, 1.5 mM ethylene glycolbis succinimidyl succinate in PBS followed by 1% formaldehyde. Crosslinked cells were lysed in 1% SDS, 10 mM EDTA, 50 mM Tris with protease inhibitors by sonication with Covaris S220. ChIP was performed by using anti-pan RAR antibody (Santa Cruz sc-773) and protein A/G agarose beads. For H3K4me3 and H3K27me3 ChIP, cells were fixed in 0.5% formaldehyde in PBS. Crosslinked cells were first lysed in 0.3M sucrose, 60 mM KCl, 15 mM NaCl, 5 mM MgCl2, 0.1 mM EDTA, 15 mM Tris, 0.5 mM DTT, 0.5% TritonX-100 with protease inhibitors, then nuclei were pelleted by centrifugation of the above lysates on 1.2 M sucrose, 60 mM KCl, 15 mM NaCl, 5 mM MgCl2, 0.1 mM EDTA, 15 mM Tris, 0.5 mM DTT. Nucleosome fractions were obtained by MNase treatment. ChIP was performed by using anti-H3K4me3 (Abcam ab8580) or anti-H3K27me3 (Upstate 07-449) and protein A/G agarose beads. For H3K27Ac ChIP, cells were fixed 1% formaldehyde in PBS. Crosslinked cells were lysed in 1% SDS, 10 mM EDTA, 50 mM Tris with protease inhibitors by sonication with Covaris S220. ChIP was performed by using anti-H3K27Ac (Active motif 39133) and protein A/G agarose beads. Eluates were treated with RNase A and Proteinase K followed by phenol/chloroform extraction and ethanol precipitation of DNA. 
For RAR, H3K4me3 and H3K27me3 ChIP, libraries were constructed from one (RAR) or five (H3K4me3 and H3K27me3) nanogram of ChIP DNA and five nanogram of input DNA using Illumina ChIP-seq sample prep kit (Illumina) and sequenced by GAIIX with Illumina Sequencing kit v4. For H3K27Ac ChIP-seq, libraries were constructed from one nanogram of ChIP DNA using TruSeq ChIP Sample Preparation Kit (Illumina) and sequenced by MiSeq with MiSeq Reagent Kit v2 (Illumina). 
 
Library strategy ChIP-Seq
Library source genomic
Library selection ChIP
Instrument model Illumina Genome Analyzer IIx
 
Data processing ChIPseq reads were aligned to the mouse genome (mm10) using Bowtie2 2.3.4.1.
Macs2 2.1.0 callpeak and bdgcomp were used to process aligned ChIPseq reads.
Genome_build: mm10
Supplementary_files_format_and_content: Bdg files were generated by Macs2 2.1.0. Data represent fragment pileup per million reads subtracted by control lambda values.
 
Submission date Jul 09, 2018
Last update date Feb 06, 2020
Contact name Shinichiro Chuma
E-mail(s) chuma.shinichiro.3x@kyoto-u.ac.jp
Phone +81-75-751-3821
Organization name Kyoto university
Department Institute for Frontier Life and Medical Sciences
Lab Laboratory of Developmental Epigenome
Street address 53 Kawahara-cho, Shogoin, Sakyo-ku
City Kyoto
State/province Kyoto
ZIP/Postal code 606-8507
Country Japan
 
Platform ID GPL11002
Series (2)
GSE116784 Transcriptomic and epigenetic profiling of genome control in the germline stem cell cycle in mice [ChIP-seq]
GSE116798 Transcriptomic and epigenetic profiling of genome control in the germline stem cell cycle in mice
Relations
BioSample SAMN09632143
SRA SRX4369779

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap