|
Status |
Public on Feb 06, 2020 |
Title |
GS RA24h RNA |
Sample type |
SRA |
|
|
Source name |
GS RA24h
|
Organism |
Mus musculus |
Characteristics |
cell type: Germline stem (GS) cell line Sex: male treatment: 100 nM retinoic acid for 24 hours
|
Treatment protocol |
100 nM retinoic acid was added to the culture media for times indicated in the file names. BAX shRNA lentivirus vectors (GAGATGAACTGGACAGCAATA, TCAAGGCCCTGTGCACTAAAG) were transduced to GS cells in order to suppress apoptosis in response to retinoic acid.
|
Growth protocol |
Germline stem (GS) cells (kindly provided by Dr Takashi Shinohara) were cultured on mitomycin C treated primary embryonic fibroblast (PEF) cells according to the previous report (Kanatsu-Shinohara et al., Biol Reprod., 2003, 69, 612-616) with minor modifications. Before GS cell sampling, PEF cells were removed by a differential attachment method to gelatin coated dishes following standard procedures. Embryonic stem (ES) cells (kindly provided by Dr Junichi Takeda) were grown in feeder-free naive state (2iLIF) conditions according to the previous report (Ying et al., Nature, 2008, 453, 519-523) with minor modifications. Primary embryonic fibroblast (PEF) cells were prepared from mouse embryos according to standard procedures and used for experiments at three to five passages .
|
Extracted molecule |
polyA RNA |
Extraction protocol |
Total RNAs were extracted with Trizol reagent (Invitrogen) according to the manufacturer's instructions. Agilent 2100 bioanalyzer was used to assess the quality of total RNAs (RIN > 8). Libraries were constructed from one microgram of total RNA using TruSeq RNA Sample Preparation Kit v2 (illumina) and sequenced by MiSeq with MiSeq Reagent Kit v2 (Illumina) .
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina MiSeq |
|
|
Data processing |
RNA-seq reads were aligned to the mouse genome (mm10) using Hisat2 2.1.0. Fragments per kilobase of exon per million mapped fragments (FPKM) were calculated by Cufflinks 2.2.1. Genome_build: mm10 Supplementary_files_format_and_content: Text files including FPKM values calculated by Cufflinks 2.2.1.
|
|
|
Submission date |
Jul 09, 2018 |
Last update date |
Feb 07, 2020 |
Contact name |
Shinichiro Chuma |
E-mail(s) |
chuma.shinichiro.3x@kyoto-u.ac.jp
|
Phone |
+81-75-751-3821
|
Organization name |
Kyoto university
|
Department |
Institute for Frontier Life and Medical Sciences
|
Lab |
Laboratory of Developmental Epigenome
|
Street address |
53 Kawahara-cho, Shogoin, Sakyo-ku
|
City |
Kyoto |
State/province |
Kyoto |
ZIP/Postal code |
606-8507 |
Country |
Japan |
|
|
Platform ID |
GPL16417 |
Series (2) |
GSE116779 |
Transcriptomic and epigenetic profiling of genome control in the germline stem cell cycle in mice [RNA-seq] |
GSE116798 |
Transcriptomic and epigenetic profiling of genome control in the germline stem cell cycle in mice |
|
Relations |
BioSample |
SAMN09631361 |
SRA |
SRX4368809 |