GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM3239698

Query DataSets for GSM3239698

Status

Public on Jul 02, 2018

Title

CoPRO_K562_Capped_Rep1_Amplified

Sample type

SRA

Source name

K562 chronic myelogenous leukemia

Organism

Homo sapiens

Characteristics

cell line: K562
5' end state: Capped RNA only
replicate: Replicate 1
pcr amplified?: Amplified
3' ligated adapter: /5Phos/rGrArCrUrUrGrArGrArUrCrGrUrCrGrGrArCrUrGrUrArGrArArCrUrCrUrGrArArC/3InvdT/

Treatment protocol

Heat shock was performed exactly as described in Mahat 2016 (PMID 27052732).

Growth protocol

K562 cells were obtained from ATCC and cultured antibiotic-free in accordance with their standards in DMEM, high glucose + HEPES (ThermoFisher cat. 12430054) supplemented with 10% FBS (ThermoFisher 10437028). Cultures were verified to be mycoplasma-free prior to library preparation and sequencing. Two biological replicates were cultured independently, separated by two passages, with library preparations done separately for technical and biological replicates. Drosophila S2 cells (grown in M3+BPYE supplemented with 10% FBS) were spiked in at a ratio of 1:1000 during permeabilization.

Extracted molecule

total RNA

Extraction protocol

Cell Permeabilization: Cells are spun down and resuspended in cold 1xPBS, then spun down and resuspended in 5 mL cold Wash Buffer (10 mM Tris-Cl, pH 7.5, 10 mM KCl, 150 mM sucrose, 5 mM MgCl2, 0.5 mM CaCl2, 0.5 mM DTT, 1x Protease Inhibitor (Sigma-Aldrich 11873580001), and 40 units SuperaseIn RNase inhibitor /10 mL (Thermo-Fischer AM2694)). Cells are spun down and lysed in Permeabilization Buffer (10 mM Tris-Cl, pH 7.5, 10 mM KCl, 250 mM sucrose, 5 mM MgCl2, 1 mM EGTA, 0.5 mM DTT, 0.05% Tween-20, 0.1% NP40, 1x Protease Inhibitor, and 40 units SuperaseIn RNase inhibitor /10 mL). Permeabilized cells are then washed twice in Wash buffer, washed once in Freezing Buffer (50 mM Tris-Cl pH 7.5, 40% glycerol, 5 mM MgCl2, 0.1 mM EDTA, 0.5 mM DTT), snap frozen in Freezing Buffer in liquid nitrogen, and stored at -80°C.
CoPRO-seq library construction: CoPRO is similar to PRO-seq, as described previously (Kwak et al., 2013, Mahat et al, 2016). Briefly, 2×10^7 nuclei per final library were added to 2x Nuclear Run-On reaction mix (10mM Tris-Cl pH 8.0, 5mM MgCl2, 300mM KCl, 1% Sarkosyl, 1mM DTT, 0.05mM each of biotin-11-A/C/G/UTP (PerkinElmer), 0.4 u/µL RNase inhibitor) and incubated for 3 min at 37°C. Total RNA was extracted, nascent RNA was purified using streptavidin beads, and then ligated with reverse 3' RNA adapter (adapter sequence varies for each sample as sample barcodes are added at this step) and biotin-labeled products were enriched by another round of streptavidin bead binding and extraction. At this point, each library was subjected to a series of enzymatic treatments to specifically enrich for different 5’ cap states (each treatment reduces a specific subset of RNAs to 5’ monophosphate to facilitate 5’ adapter ligation, described in the Samples section). Cap state selected RNA was ligated to reverse 5' RNA adapter (5'- rCrArArGrCrArGrArArGrArCrGrGrCrArUrArCrGrArGrArUrGrUrCrUrCrGrUrGrGrGrCrUrCrGrGrArGrArUrGrUrGrUrArUrArArGrArGrArCrArG-3') before being further purified by a third round of streptavidin bead binding and extraction. RNA was reverse transcribed using the Illumina RP1 primer (AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA). Each K562 library was sequenced by loading cDNA on the instrument directly (PCR free, two separate lanes, Lane1 and Lane2), and after PCR amplification (described for each entry in the Samples section). For PCR amplified samples, cDNA was amplified with the following primers: CAAGCAGAAGACGGCATACGAGATGTC and CAAGCAGAAGACGGCATACGAGATGTC, after which products greater than 120 bp were PAGE purified and pooled for sequencing.

Library strategy

OTHER

Library source

transcriptomic

Library selection

other

Instrument model

Illumina NextSeq 500

Description

Capped RNAs were selected by treating with Terminator 5’ Phosphate dependent exonuclease (Epicentre, cat. TER51020) to degrade 5’ monophosphate RNA (from terminating polymerase) and CIP to reduce other uncapped RNAs to 5’ hydroxyl, making them incapable of ligating to 5’ adapter. 5’ cap was removed with RNA 5’ pyrophosphohydrolase, RppH (NEB, cat. M0356S), using ThermoPol buffer (NEB, cat. B9004S).
CoPRO_AllMerge_Cap_5p_pl.bw
CoPRO_AllMerge_Cap_5p_mn.bw
CoPRO_AllMerge_Cap_3p_pl.bw
CoPRO_AllMerge_Cap_3p_mn.bw
CoPRO_AllMerge_Pooled.Rdata
CoPRO_Rep1_Pooled.Rdata

Data processing

Library strategy: CoPRO
Adaptors were trimmed using cutadapt 1.16 (-O 1 -m 18).
Reads were aligned to hg19 with bowtie2 v2.2.6 (--very-sensitive -X 1000 --no-mixed --no-discordant --no-unal).
Alignments from different sequencing runs were pooled using samtools merge.
After pooling, reads with mappability score less than 30 were removed; the biotin run-on base was trimmed; and reads were weighted to account for the bias of Illumina sequencers using custom R scripts.
Separate bigwig files were generated from weighted 5' and 3' end counts (please note that this does not preserve the single-molecule resolution of the dataset).
All processing code is available at https://github.com/ndt26/CoPRO
Genome_build: hg19
Supplementary_files_format_and_content: bigwig files containing pooled sequencing runs for each cap state selection treatment (pooling the two replicates and three sequencing runs per library). For each treatment, two pairs of bigwigs are provided (a pair consists of separate files for reads mapping to the plus and minus strands, minus strand values are negative). One set contains reads mapped to single baspairs at the 5’ end of the RNA (i.e. reflecting the exact basepair where a Pol II molecule initiated), and the other mapped to the 3’ ends (i.e. the location of the active site of polymerase). Each library was sequenced in three runs: two by loading cDNA directly (Lane1 and Lane2) and one after amplification (Amplified)
Supplementary_files_format_and_content: Rdata files containing pooled sequencing runs with normalized counts for all treatments. Rdata files are provided for each replicate, and a file that combines data from both replicates.

Submission date

Jul 01, 2018

Last update date

Jul 02, 2018

Contact name

Jacob Michael Tome

E-mail(s)

jacobmtome@gmail.com

Organization name

Cornell University

Department

Molecular Biology and Genetics