|
| Status |
Public on Jun 04, 2020 |
| Title |
D0-OE |
| Sample type |
SRA |
| |
|
| Source name |
U87 cell
|
| Organism |
Homo sapiens |
| Characteristics |
cell type: glioblastoma cells
cell line: U87
genotype: U87 cells transduced with lentivirus encoding EGFRvIII
|
| Treatment protocol |
U87 cell line was first transduced with vector or EGFRvIII-encoding lentivirus, followed by 7 days’ G-418 selection. Then cells were infected with the pooled GeCKOv2 human lentiviral library at an multiplicity of infection (MOI) of 0.3 to ensure that most cells receive only one stably integrated RNA guide. At day 2, puromycin was added to the cells to select the positive transduced cells. At day 9, cells were treated with 350 µM TMZ.
|
| Growth protocol |
The cells were routinely maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) with 10% heat-inactivated fetal bovine serum (FBS, HyClone, Logan, UT, USA) in a humidified 5% CO2 atmosphere at 37℃.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Genomic DNA extraction were preformed by a ammonium acetate and alcohol precipitation precedures. 1*10^8 cells were homogenized in 15 mL 4 M guanidine thiocyanate with RNaseA, after incubated at 37 oC for 30 mins,15 mL 8 M ammonium acetate were added and mixing. To precipitate DNA, 15 mL isopanol were added and mixing vigorously, the DNA were hooked to a new tube and washed by 70% ethanol. DNA were dissolved in 3 mL TE and extacted by 2 round of choloform.
Two-step PCR amplification were performed on genomic DNA using Hifi DNA polymerase (Vazyme). The first PCR using Outer-F(CTTGGCTTTATATATCTTGTGGAAAGGAC)and Outer-R(GGAAAAAGGCGGAGCCAGTACACGAC) to primeramplification the region containing sgRNA cassette. The second PCR included amplification to attach Illumina adaptors and to barcode samples(F:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTgtggaaaggacgaaacaccg, R:CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGCCAGTACACGACATCACTTTCC).The samples were multiplexing and sequencing in a single HiSeq-X run.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
HiSeq X Ten |
| |
|
| Data processing |
Illumina Casava1.8.2 software used for basecalling.
Data processing were performed as Shalem O et al., Science, 2014.
Raw FASTQ files were demultiplexed using FASTX-Toolkit and processed to only contain the unique sgRNA sequence.
The sgRNA reads were aligned to the designed sgRNA sequence library using Bowite2.
sgRNA counts were normaliezd using the formula: normalized sgRNA counts=(reads per sgRNA/total reads for all sgRNA in samples)*10^6+1
Genome_build: hg19
Supplementary_files_format_and_content: excel format files include sgRNA counts
|
| |
|
| Submission date |
Apr 05, 2018 |
| Last update date |
Jun 04, 2020 |
| Contact name |
Kai Huang |
| E-mail(s) |
huangkai@tijmu.edu.cn
|
| Phone |
13752390609
|
| Organization name |
tianjin medical university
|
| Street address |
anshan roud
|
| City |
tianjin |
| ZIP/Postal code |
300054 |
| Country |
China |
| |
|
| Platform ID |
GPL20795 |
| Series (2) |
| GSE112733 |
A genome-wide screen identifies E2F6 as critical factor for TMZ chemoresistance in EGFRvIII expressing GBM (DNA-seq) |
| GSE112736 |
A genome-wide screen identifies E2F6 as critical factor for TMZ chemoresistance in EGFRvIII expressing GBM |
|
| Relations |
| BioSample |
SAMN08868561 |
| SRA |
SRX3889267 |
