GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM3071483

Query DataSets for GSM3071483

Status

Public on Nov 20, 2018

Title

ansc_ko_rna_rep1

Sample type

SRA

Source name

Dentate gyrus

Organism

Mus musculus

Characteristics

tissue: Dentate gyrus
cell type: Adult neural stem cells
strain: FVB/N
genotype: Fmr1-/y
Sex: male
age: 8-10 weeks

Treatment protocol

Cycloheximide (CHX, Sigma-Aldrich, #C7698) was added into cultured aNSCs to a final concentration of 100μg/ml, and let cells incubate at 37 °C for 10 min in order to stabilize ribosomes. Then, cells were transported to cold room and spun down gently at 1000g for 3 min and the supernatant was carefully discarded. Cells were washed twice with ice-cold PBS containing 100μg/ml CHX and were spun down at 1000g for 3 minutes. The supernatant was carefully removed to collect the cell pellet. The cell pellet was immediately stored and kept in -80 °C freezer for later analysis.

Growth protocol

Adult-derived NSCs were isolated from the dentate gyrus (DG) of 8- to 10-week-old male Fmr1 KO mice and wild-type (WT) littermate controls based on our published method (Guo et al., 2012). Briefly, DG were dissected using forceps and 27gauge needle (BD, #305109) and placed in Hank’s balanced salt solution (HBSS, Invitrogen, # 14025-126) on ice. Tissue was spun down and digested using MACS Neural Tissue Dissociation kit (Miltenyi Biotech, #130-090-753). After dissociation with a fire-polished glass pipette, cells were filtered through a 70-μm cell strainer (BD Falcon, #252350) and washed with HBSS, the single-cell suspension from each sample was collected and cultured in proliferation medium [Neurobasal medium containing B27 serum-free supplement (Invitrogen, #17504-044), 20 ng/ml basic fibroblast growth factor (FGF-2, PeproTech, #K1606), 20 ng/ml epidermal growth factor (EGF, PeproTech, #A2306), 1% Antibiotic-Antimycotic, and 2 mM L-glutamine], in a 5% CO2 incubator at 37°C. Half of the medium was replaced every two days. Independently isolated cells serve as biological replicates.

Extracted molecule

total RNA

Extraction protocol

Frozen cell pellets were thawed in ice-cold polysome lysis buffer [20mM Tris-HCl pH7.4, 5mM MgCl2, 100mM KCl, 1mM DTT, 100ug/ml cycloheximide, 25U/ml Turbo DNaseI (Ambion, #AM2238), 1% TritonX-100 in nuclease-free water] and lysed by trituration through a 25-G need for 10 times. After 10-min incubation on ice, lysates were clarified by centrifugation at 14,000g 4 °C for 10min. The supernatants were collected and the amounts of nucleic acids (A260 units) were measured with Nanodrop (Thermo Fisher Scientific). For each sample, cytoplasmic RNA for RNA-seq was purified from one fourth of the lysate with TRIzol LS reagent (Invitrogen, #10296028). The other three fourths of the lysate was digested with 100ng/A260 RNase A (Ambion, #AM2270) and 60U/A260 RNAse T1 (Thermo Fisher Scientific, #EN0542) at 25°C for 30min. The digestion was stopped by adding 50U SUPERase In RNase inhibitor (Ambion, #AM2694) and chilling on ice. Digested lysates were loaded on 10%-50% sucrose gradients prepared in 1Xpolysome buffer (20mM Tris-HCl pH7.4, 5mM MgCl2, 100mM KCl, 1mM DTT, 100ug/ml cycloheximide in nuclease-free water). After the ultracentrifugation in a SW41Ti rotor (Beckman Coulter) at 35,000 rpm 4°C for 2.5 hours, gradients were fractionated at 1.5 ml/min and 12 sec collection interval through a fractionation system (Brandel) that continually monitored A260 values. Monosome fractions were identified, pooled, and extracted with TRIzol LS.
Ovation RNA‑Seq System V2 (NuGEN)
For the cytoplasmic RNA-seq, 500ng total RNA per sample was used for the library preparation with the Ovation RNA‑Seq System V2 (NuGEN, #0304) following manufacturer’s instructions. HL-dsDNase (ArcticZymes, #70800-201) method was used to eliminate DNA contamination and cDNA was fragmented with M220 Covaris Focused-ultrasonicator for a target median fragment size of 300bp (peak power: 50.0, duty factor 20.0, cycles/burst: 200, treatment time: 75sec). qPCR test was performed with EvaGreen Dye (Biotium, #31000-T) to determine the optimal PCR cycles. For the ribosome profiling samples, libraries were prepared following the published protocols (Heyer et al., 2015; Ingolia et al., 2012). Briefly, rRNA was depleted from the purified monosomal RNA samples with RiboZero (Illumina, #MRZG12324). Remaining RNA samples were separated on a 15% TBU gel (National Diagnostics, #EC-833) and the ribosome footprints were size-selected based on the 26 and 34nt markers. RNA was eluted from the crushed gel pieces in RNA elution buffer (300mM NaOAc pH5.5, 1mM EDTA, 0.25% SDS) at RT overnight, filtered with Spin-X Centrifuge Tube Filters (Corning, #8162) and precipitated with equal volume of isopropanol. Recovered RNA was dephosphorylated with T4 Polynucleotide Kinase (NEB, #M0201S) and ligated with preadenylated adaptor in miRCat®-33 Conversion Oligos Pack (IDT) using T4RNL2Tr.K227Q ligase (NEB, #M0351L). Reverse transcription was performed with RT primers with 5nt-barcode and 5nt or 8nt unique molecular identifier (UMI) and SuperScript III (Invitrogen, #18080-044) in 1X first-strand buffer without MgCl2 (50 mM Tris-HCl, pH 8.3, 75 mM KCl). RT products were separated on a 10% TBU gel and the 130-140nt region was selected. cDNA was eluted in DNA elution buffer (10mM Tris pH 8.0, 300mM NaCl, 1mM EDTA) at RT overnight, filtered, and precipitated with isopropanol. Purified cDNA was circularized with CircLigase (Epicentre, #CL4115K). cDNA derived from remaining rRNA was hybridized to biotin-labelled antisense probes (IDT) and further depleted with Dynabeads MyOne Streptavidin C1 (Inivtrogen, #65001). Optimal PCR cycle was determined empirically by test PCR reactions with titrated cycle numbers. Final PCR amplification was performed with KAPA Library Amplification Kit (Kapa Biosystems, #KK2611) and 180-190bp products were size-selected on an 8% TBE gel. DNA was eluted in DNA elution buffer and precipitated with isopropanol. The final library DNA was purified with AMPure XP beads (Beckman Coulter, #A63880)

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina NextSeq 500

Description

Cytoplamic mRNA
ansc.ribo.rna.rsem.gene.summary.counts.txt
ansc.ribo.rna.rsem.gene.summary.tpm.txt
ansc.deg.anota2seq.sva.gene.summary.txt

Data processing

Basecallling and fastq file generation were performed by Illumina Basespace.
For ribosome profiling data, individual samples were separated from the raw fastq files based on the barcode sequences. Barcode and UMI sequences were trimmed and moved to the read names. Adaptor sequences (TGGAATTCTCGGGTGCCAAGGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG) were removed with cutadapt (1.7.1).
Trimmed reads were quality filtered and mapped to the mouse rRNA and then tRNA references with Bowtie2 (2.1.0). Unmapped reads were next mapped to the mm10 mouse genome with Tophat2 (2.0.9).
PCR duplicates were marked based on the UMI sequences and only uniquely mapped reads without duplicates were retained with samtools (0.0.19) for the downstream analysis.
Cleaned bam files of ribosome footprints were converted to fastq files with bedtools (2.22.0). Cleaned fastq files without rRNA or tRNA were used for RNA-seq quantification. For both ribosome profiling and RNA-seq, gene expression was quantified with RSEM (1.2.11) using the cleaned fastq files and Refseq (V69) mouse CDS without the first and last 30nt to avoid the translation initiation and termination peaks.
Genes were filtered with minimum 10 reads across all replicates and then the read counts were batch-corrected with the Combat function in sva (3.24.4) using a full model matrix.
Batch-corrected counts were normalized with trimmed mean of M values (TMM) method and used to identify differential expressed genes (DEGs) with anota2seq (1.0.0). Relaxed cut-offs (absolute fold changes > 1.2 and adjusted p-value < 0.2) were used to obtained sufficient DEGs for the downstream analysis. Instead of using the default setting, the priorities of translation and buffering groups were determined by the adjusted p-values and were set to be higher than the priority of mRNA only groups.
Genome_build: mm10
Supplementary_files_format_and_content: Tab-delimited text files include raw counts and TPM values from RSEM, as well as batch-corrected counts, TPM, and anota2seq (differential translation analysis) output values for each sample

Submission date

Mar 29, 2018

Last update date

Nov 20, 2018

Contact name

Botao Liu

Organization name

University of Massachusetts Medical School

Department

Program in Molecular Medicine

Lab

Joel Richter Lab