|
| Status |
Public on Feb 04, 2019 |
| Title |
T24h_rep1 |
| Sample type |
SRA |
| |
|
| Source name |
HuH7 human hepatocarcinoma cell line
|
| Organism |
Homo sapiens |
| Characteristics |
donor sex: Male
donor age: 57 years
donor cancer type: hepatocellular carcinoma, liver tumor
treatment dosage: 15mM APAP for 24 hours
treatment: APAP treated
|
| Treatment protocol |
HuH7 were transduced with a Cas9 LLV and subsequently with control or sgRNA library LLV to produce gene knockouts. The pooled, transduced cells were selected with 1.5µg/ml puromycin (Invitrogen cat. Ant-pr-1) for 3 days alongside cells transduced with the empty vector lentiGuidePuro, positive fluorescent control PLJM1-EGFP. After 8 days of transduction a T0 sample was collected (N=2) and the remaining library-transduced cells were treated with 15mM APAP for 30 minutes up to 4 days (2 biological replicates for T0, 24 hour, and 4 day samples). Samples that underwent 4 days of APAP treatment were outgrown for 21 days prior to collection.
|
| Growth protocol |
HuH7 cells were maintained in DMEM (Thermo Fisher cat. 111885092) supplemented with 100 U/ml penicillin and streptomycin (Thermo Fisher cat. 15140122), non-essential amino acids (Thermo Fisher cat. 11140050), and 10% fetal bovine serum (Atlanta Biologicals cat. S11150) as previously described, with the addition of 2mM L-glutamine (Thermo Fisher cat. 25030081) and 1mM sodium pyruvate (Thermo Fisher)67. Cells were detached with trypsin-EDTA (Thermo Fisher cat. 25200056). All incubations were performed at 37°C and 5% CO2.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Genomic DNA was isolated from samples of a minimum of 2E7 cells using the Blood and Cell Culture Midi Kit (Qiagen cat. 13343, Valencia, CA)
5µl amplicon or 1µl diluted plasmid library was used as template in 13 50µl Herculase II DNA polymerase reactions per sample to attach pooled variable-length spacers and Illumina indexes (custom primers, see manuscript). 24 cycles were used to amplify DNA in the first and second PCR, respectively. The amplicon fragments after PCR 2 comprise a 354-362bp library with variable 20bp sgRNA sequence in the middle. DNA was pooled by sample and purified using the Nucleospin Gel and PCR Clean-up kit (Clontech cat. 740609.250, Mountain View, CA). DNA was quantified using a Qubit high-sensitivity DNA quantification assay (Thermo Fisher cat. Q32851) and Take3 microspot plate reader (BioTek). DNA quality was analyzed by Experion CHIP assay (BioRad cat. 7007-163, Hercules, CA). Clusters were generated on the flow cell using the HiSeq Rapid Duo CBot Sample Loading Kit (Illumina CT- cat. 403-2001, San Diego, CA).
A single-read rapid run of 75 cycles was performed on a HiSeq 1500 (Illumina cat. GD-402-4002) using the HiSeq Rapid SBS kit (Illumina cat. FC-402-4022) with 10% PhiX.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
genomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 1500 |
| |
|
| Description |
raw_read_counts.txt
|
| Data processing |
The sequence reads were demultiplexed and converted to fastQ with BCL2FastQ v2.17
The fastq files were trimmed in cutadapt 1.7.1 (with Python 2.7.6) to include only the 20bp sgRNA using the 5’ sequence GTGGAAAGGACGAAACACCG and the 3’ sequence GTTTTAGAGCTAGA
Trimmed reads were aligned to the index in Bowtie2 v2.1 with a 1bp mismatch allowance
Raw read counts were calculated in unix and combined across the 4 technical replicates per sample
Read counts were normalized to the median with T0 as control and analyzed using sgRNA and gene-level RRA (Robust Rank Aggregation) in MaGeCK v0.5.6
Genome_build: GeKOv2 sgRNA library index
Supplementary_files_format_and_content: tab-delimited text file of a matrix table of raw read counts.
|
| |
|
| Submission date |
Mar 28, 2018 |
| Last update date |
Feb 04, 2019 |
| Contact name |
Shui Q Ye |
| Organization name |
University of Missouri Kansas City School of Medicine
|
| Department |
Departmetn of Biomedical and Health Informatics
|
| Street address |
2411 Holmes Street
|
| City |
Kansas City |
| State/province |
MO |
| ZIP/Postal code |
64108 |
| Country |
USA |
| |
|
| Platform ID |
GPL18460 |
| Series (1) |
| GSE112463 |
Identification of Novel Regulatory Genes in APAP Induced Hepatocyte Toxicity by a Genome-Wide CRISPR-Cas9 Screen |
|
| Relations |
| BioSample |
SAMN08811313 |
| SRA |
SRX3859238 |
